Incidental Mutation 'R7288:Dhx34'
ID566155
Institutional Source Beutler Lab
Gene Symbol Dhx34
Ensembl Gene ENSMUSG00000006019
Gene NameDEAH (Asp-Glu-Ala-His) box polypeptide 34
Synonyms1200013B07Rik, Ddx34, 1810012L18Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.238) question?
Stock #R7288 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location16197147-16222037 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 16215436 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 356 (S356P)
Ref Sequence ENSEMBL: ENSMUSP00000092410 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094816] [ENSMUST00000118795] [ENSMUST00000119102] [ENSMUST00000121123] [ENSMUST00000163968]
Predicted Effect probably benign
Transcript: ENSMUST00000094816
AA Change: S356P

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000092410
Gene: ENSMUSG00000006019
AA Change: S356P

DomainStartEndE-ValueType
low complexity region 4 26 N/A INTRINSIC
low complexity region 118 131 N/A INTRINSIC
DEXDc 150 343 7.73e-28 SMART
HELICc 400 498 4.31e-17 SMART
low complexity region 542 553 N/A INTRINSIC
HA2 558 648 3.35e-21 SMART
Pfam:OB_NTP_bind 687 911 2.6e-24 PFAM
low complexity region 953 971 N/A INTRINSIC
ZnF_C2H2 1121 1144 7.89e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118795
AA Change: S356P

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000112865
Gene: ENSMUSG00000006019
AA Change: S356P

DomainStartEndE-ValueType
low complexity region 4 26 N/A INTRINSIC
low complexity region 118 131 N/A INTRINSIC
DEXDc 150 343 7.73e-28 SMART
HELICc 400 498 4.31e-17 SMART
low complexity region 542 553 N/A INTRINSIC
HA2 558 648 3.35e-21 SMART
Pfam:OB_NTP_bind 687 911 7.5e-17 PFAM
low complexity region 953 971 N/A INTRINSIC
ZnF_C2H2 1121 1144 7.89e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119102
AA Change: S356P

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000113393
Gene: ENSMUSG00000006019
AA Change: S356P

DomainStartEndE-ValueType
low complexity region 4 26 N/A INTRINSIC
low complexity region 118 131 N/A INTRINSIC
DEXDc 150 343 7.73e-28 SMART
HELICc 400 498 4.31e-17 SMART
low complexity region 542 553 N/A INTRINSIC
HA2 558 648 3.35e-21 SMART
Pfam:OB_NTP_bind 687 911 7.5e-17 PFAM
low complexity region 953 971 N/A INTRINSIC
ZnF_C2H2 1121 1144 7.89e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121123
AA Change: S356P

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000113673
Gene: ENSMUSG00000006019
AA Change: S356P

DomainStartEndE-ValueType
low complexity region 4 26 N/A INTRINSIC
low complexity region 118 131 N/A INTRINSIC
DEXDc 150 343 7.73e-28 SMART
HELICc 400 498 4.31e-17 SMART
low complexity region 542 553 N/A INTRINSIC
HA2 558 648 3.35e-21 SMART
Pfam:OB_NTP_bind 687 911 7.5e-17 PFAM
low complexity region 953 971 N/A INTRINSIC
ZnF_C2H2 1121 1144 7.89e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163968
AA Change: S356P

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000126915
Gene: ENSMUSG00000006019
AA Change: S356P

DomainStartEndE-ValueType
low complexity region 4 26 N/A INTRINSIC
low complexity region 118 131 N/A INTRINSIC
DEXDc 150 343 7.73e-28 SMART
HELICc 400 498 4.31e-17 SMART
low complexity region 542 553 N/A INTRINSIC
HA2 558 648 3.35e-21 SMART
Pfam:OB_NTP_bind 687 911 6.4e-18 PFAM
low complexity region 953 971 N/A INTRINSIC
ZnF_C2H2 1121 1144 7.89e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a member of this family. It is mapped to the glioma 19q tumor suppressor region and is a tumor suppressor candidate gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik T A 11: 58,880,305 D204E probably benign Het
Adh1 T G 3: 138,282,732 D155E probably benign Het
Akt1s1 T C 7: 44,849,147 L2P unknown Het
Ash1l T A 3: 88,965,892 probably benign Het
Bend7 C T 2: 4,752,830 P228S probably damaging Het
Bpifc T C 10: 85,988,721 E218G possibly damaging Het
Cdk6 T A 5: 3,429,001 F127Y probably benign Het
Cgnl1 A T 9: 71,725,564 H168Q possibly damaging Het
Chd7 C T 4: 8,847,093 T1612I possibly damaging Het
Col4a4 A T 1: 82,492,463 C782S unknown Het
Copg2 T A 6: 30,824,406 I364L probably damaging Het
Crygb A G 1: 65,081,925 L81P probably benign Het
Cyp4f18 A T 8: 71,993,173 M326K probably damaging Het
Dmbt1 C T 7: 131,083,789 Q855* probably null Het
Dnph1 A G 17: 46,499,012 N160S probably benign Het
Esrra A T 19: 6,912,771 C228* probably null Het
Evpl T C 11: 116,223,949 N972D probably benign Het
Fat3 T C 9: 15,998,592 D2038G probably damaging Het
Fhit T A 14: 9,763,784 R102W probably damaging Het
Gal3st1 A T 11: 3,998,609 D272V probably damaging Het
Gal3st1 T A 11: 3,998,651 V286D probably damaging Het
Gemin4 A T 11: 76,213,380 M185K possibly damaging Het
Hecw1 T C 13: 14,316,236 I311V probably benign Het
Ift172 T C 5: 31,285,286 Y179C probably damaging Het
Ighv7-3 C T 12: 114,153,343 W66* probably null Het
Iqgap3 T A 3: 88,108,835 I975N probably damaging Het
Khdrbs3 A G 15: 69,049,413 E281G possibly damaging Het
Lamb2 A T 9: 108,488,324 T1369S probably benign Het
Mettl8 A T 2: 70,982,038 D84E probably benign Het
Mrgprb3 C A 7: 48,643,311 C164F probably damaging Het
Mtg2 A G 2: 180,083,387 Y131C probably damaging Het
Nacc1 C T 8: 84,676,545 A234T probably benign Het
Nsmaf C T 4: 6,416,641 V551I probably benign Het
Olfr541 T A 7: 140,705,029 C259* probably null Het
Olfr869 T A 9: 20,137,441 Y108* probably null Het
Oxr1 C T 15: 41,813,608 P187L not run Het
Pcdhb12 T A 18: 37,436,015 D71E probably benign Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,499,669 probably null Het
Pkm A G 9: 59,668,913 S127G probably benign Het
Plxna2 T A 1: 194,796,919 L1296H probably damaging Het
Ppil6 C G 10: 41,498,528 T135R probably benign Het
Ppp2r3a T C 9: 101,127,004 Y378C probably damaging Het
Rabep2 C T 7: 126,444,205 R426C probably damaging Het
Rad21 A T 15: 51,982,580 H31Q possibly damaging Het
Rad50 G T 11: 53,654,949 Y1182* probably null Het
Serpinb9c C T 13: 33,151,900 A218T possibly damaging Het
Slc17a2 C A 13: 23,819,112 H248Q probably benign Het
Slc45a4 C A 15: 73,586,936 E255* probably null Het
Slc8a3 T A 12: 81,216,824 K596N possibly damaging Het
Tbc1d32 A C 10: 56,051,387 probably null Het
Tbl2 T A 5: 135,154,399 I112N possibly damaging Het
Tchp A C 5: 114,715,569 K238T probably damaging Het
Tfap2d G A 1: 19,118,983 G251D probably damaging Het
Thrb T A 14: 18,030,186 M324K probably damaging Het
Tmem259 A T 10: 79,978,466 L328Q probably damaging Het
Tmtc2 T C 10: 105,413,608 H88R probably damaging Het
Tnfrsf21 A G 17: 43,037,818 H107R possibly damaging Het
Trib1 T C 15: 59,654,622 V347A probably benign Het
Ung T A 5: 114,131,254 L9* probably null Het
Vmn1r195 G T 13: 22,279,004 V215F probably damaging Het
Wdr63 T C 3: 146,081,252 T343A probably damaging Het
Wdr90 A G 17: 25,846,312 S1657P probably benign Het
Wdsub1 A T 2: 59,878,143 Y129N possibly damaging Het
Zfp369 T G 13: 65,285,018 probably null Het
Zfp770 G T 2: 114,195,661 C642* probably null Het
Zfp981 C T 4: 146,537,643 R342C probably benign Het
Zhx3 A C 2: 160,781,122 V375G probably damaging Het
Other mutations in Dhx34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Dhx34 APN 7 16199826 missense probably damaging 1.00
IGL01090:Dhx34 APN 7 16216256 missense probably damaging 1.00
IGL01397:Dhx34 APN 7 16210543 missense probably damaging 1.00
IGL01637:Dhx34 APN 7 16205473 missense probably damaging 1.00
IGL01684:Dhx34 APN 7 16203279 missense probably damaging 1.00
IGL02147:Dhx34 APN 7 16204003 missense probably benign 0.01
IGL02223:Dhx34 APN 7 16198659 missense probably benign 0.10
R0255:Dhx34 UTSW 7 16205992 missense probably benign 0.32
R0514:Dhx34 UTSW 7 16210537 missense probably benign 0.02
R0919:Dhx34 UTSW 7 16201958 missense probably damaging 0.99
R1075:Dhx34 UTSW 7 16218349 missense probably benign 0.06
R1077:Dhx34 UTSW 7 16218368 missense probably damaging 0.97
R4197:Dhx34 UTSW 7 16203726 missense probably damaging 1.00
R4721:Dhx34 UTSW 7 16197382 missense possibly damaging 0.83
R4856:Dhx34 UTSW 7 16215442 missense possibly damaging 0.94
R4868:Dhx34 UTSW 7 16199802 missense probably benign 0.10
R5134:Dhx34 UTSW 7 16218250 missense possibly damaging 0.57
R5180:Dhx34 UTSW 7 16205480 nonsense probably null
R5560:Dhx34 UTSW 7 16218541 missense probably benign 0.34
R5588:Dhx34 UTSW 7 16198900 missense probably damaging 0.99
R6981:Dhx34 UTSW 7 16215330 missense possibly damaging 0.87
R6994:Dhx34 UTSW 7 16203874 missense probably benign 0.04
R7226:Dhx34 UTSW 7 16198876 missense probably damaging 1.00
R7262:Dhx34 UTSW 7 16203698 missense probably benign 0.01
R7381:Dhx34 UTSW 7 16215448 missense probably benign 0.00
R7469:Dhx34 UTSW 7 16216439 missense probably benign 0.00
R7709:Dhx34 UTSW 7 16212864 missense possibly damaging 0.55
X0020:Dhx34 UTSW 7 16205992 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- TGTCCTGGTCAGACACAGAGAG -3'
(R):5'- TAGCACTGTCAGCACCTCAG -3'

Sequencing Primer
(F):5'- TCAGACACAGAGAGGGCGC -3'
(R):5'- AGTGTGCCACCTACCAA -3'
Posted On2019-06-26