Incidental Mutation 'R7288:Akt1s1'
ID566156
Institutional Source Beutler Lab
Gene Symbol Akt1s1
Ensembl Gene ENSMUSG00000011096
Gene NameAKT1 substrate 1 (proline-rich)
SynonymsLobe, PRAS40, 1110012J22Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R7288 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location44848991-44855421 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 44849147 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 2 (L2P)
Ref Sequence ENSEMBL: ENSMUSP00000103517 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047085] [ENSMUST00000054343] [ENSMUST00000107880] [ENSMUST00000107882] [ENSMUST00000107885] [ENSMUST00000127783] [ENSMUST00000136232] [ENSMUST00000141311] [ENSMUST00000145959] [ENSMUST00000150335] [ENSMUST00000207223] [ENSMUST00000207293] [ENSMUST00000207532] [ENSMUST00000208384]
Predicted Effect probably benign
Transcript: ENSMUST00000047085
SMART Domains Protein: ENSMUSP00000048260
Gene: ENSMUSG00000038520

DomainStartEndE-ValueType
Pfam:DUF3548 3 217 8.2e-93 PFAM
low complexity region 249 259 N/A INTRINSIC
TBC 307 545 3.93e-54 SMART
Blast:TBC 554 594 1e-6 BLAST
low complexity region 597 631 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000054343
SMART Domains Protein: ENSMUSP00000049764
Gene: ENSMUSG00000011096

DomainStartEndE-ValueType
low complexity region 33 60 N/A INTRINSIC
low complexity region 66 101 N/A INTRINSIC
low complexity region 102 116 N/A INTRINSIC
low complexity region 161 180 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107880
SMART Domains Protein: ENSMUSP00000103512
Gene: ENSMUSG00000011096

DomainStartEndE-ValueType
low complexity region 33 60 N/A INTRINSIC
low complexity region 66 101 N/A INTRINSIC
low complexity region 102 116 N/A INTRINSIC
low complexity region 161 180 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107882
SMART Domains Protein: ENSMUSP00000103514
Gene: ENSMUSG00000011096

DomainStartEndE-ValueType
low complexity region 59 86 N/A INTRINSIC
low complexity region 92 127 N/A INTRINSIC
low complexity region 128 142 N/A INTRINSIC
low complexity region 187 206 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000107885
AA Change: L2P
SMART Domains Protein: ENSMUSP00000103517
Gene: ENSMUSG00000011096
AA Change: L2P

DomainStartEndE-ValueType
low complexity region 104 131 N/A INTRINSIC
low complexity region 137 172 N/A INTRINSIC
low complexity region 173 187 N/A INTRINSIC
Pfam:PRAS 199 323 1.2e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127783
SMART Domains Protein: ENSMUSP00000116149
Gene: ENSMUSG00000011096

DomainStartEndE-ValueType
low complexity region 33 60 N/A INTRINSIC
low complexity region 66 101 N/A INTRINSIC
low complexity region 102 116 N/A INTRINSIC
Pfam:PRAS 134 247 1.3e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136232
SMART Domains Protein: ENSMUSP00000116541
Gene: ENSMUSG00000011096

DomainStartEndE-ValueType
low complexity region 33 60 N/A INTRINSIC
low complexity region 66 95 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141311
SMART Domains Protein: ENSMUSP00000120690
Gene: ENSMUSG00000011096

DomainStartEndE-ValueType
low complexity region 40 67 N/A INTRINSIC
low complexity region 73 108 N/A INTRINSIC
low complexity region 109 123 N/A INTRINSIC
low complexity region 168 187 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142880
Predicted Effect probably benign
Transcript: ENSMUST00000145959
SMART Domains Protein: ENSMUSP00000121546
Gene: ENSMUSG00000038520

DomainStartEndE-ValueType
Pfam:DUF3548 3 217 5.8e-93 PFAM
low complexity region 249 259 N/A INTRINSIC
TBC 307 544 3.91e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150335
SMART Domains Protein: ENSMUSP00000122607
Gene: ENSMUSG00000011096

DomainStartEndE-ValueType
low complexity region 33 60 N/A INTRINSIC
low complexity region 66 101 N/A INTRINSIC
low complexity region 102 116 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207223
Predicted Effect probably benign
Transcript: ENSMUST00000207293
Predicted Effect probably benign
Transcript: ENSMUST00000207532
Predicted Effect probably benign
Transcript: ENSMUST00000208384
Predicted Effect probably benign
Transcript: ENSMUST00000208890
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] AKT1S1 is a proline-rich substrate of AKT (MIM 164730) that binds 14-3-3 protein (see YWHAH, MIM 113508) when phosphorylated (Kovacina et al., 2003 [PubMed 12524439]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to induced ischemic brain injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik T A 11: 58,880,305 D204E probably benign Het
Adh1 T G 3: 138,282,732 D155E probably benign Het
Ash1l T A 3: 88,965,892 probably benign Het
Bend7 C T 2: 4,752,830 P228S probably damaging Het
Bpifc T C 10: 85,988,721 E218G possibly damaging Het
Cdk6 T A 5: 3,429,001 F127Y probably benign Het
Cgnl1 A T 9: 71,725,564 H168Q possibly damaging Het
Chd7 C T 4: 8,847,093 T1612I possibly damaging Het
Col4a4 A T 1: 82,492,463 C782S unknown Het
Copg2 T A 6: 30,824,406 I364L probably damaging Het
Crygb A G 1: 65,081,925 L81P probably benign Het
Cyp4f18 A T 8: 71,993,173 M326K probably damaging Het
Dhx34 A G 7: 16,215,436 S356P probably benign Het
Dmbt1 C T 7: 131,083,789 Q855* probably null Het
Dnph1 A G 17: 46,499,012 N160S probably benign Het
Esrra A T 19: 6,912,771 C228* probably null Het
Evpl T C 11: 116,223,949 N972D probably benign Het
Fat3 T C 9: 15,998,592 D2038G probably damaging Het
Fhit T A 14: 9,763,784 R102W probably damaging Het
Gal3st1 A T 11: 3,998,609 D272V probably damaging Het
Gal3st1 T A 11: 3,998,651 V286D probably damaging Het
Gemin4 A T 11: 76,213,380 M185K possibly damaging Het
Hecw1 T C 13: 14,316,236 I311V probably benign Het
Ift172 T C 5: 31,285,286 Y179C probably damaging Het
Ighv7-3 C T 12: 114,153,343 W66* probably null Het
Iqgap3 T A 3: 88,108,835 I975N probably damaging Het
Khdrbs3 A G 15: 69,049,413 E281G possibly damaging Het
Lamb2 A T 9: 108,488,324 T1369S probably benign Het
Mettl8 A T 2: 70,982,038 D84E probably benign Het
Mrgprb3 C A 7: 48,643,311 C164F probably damaging Het
Mtg2 A G 2: 180,083,387 Y131C probably damaging Het
Nacc1 C T 8: 84,676,545 A234T probably benign Het
Nsmaf C T 4: 6,416,641 V551I probably benign Het
Olfr541 T A 7: 140,705,029 C259* probably null Het
Olfr869 T A 9: 20,137,441 Y108* probably null Het
Oxr1 C T 15: 41,813,608 P187L not run Het
Pcdhb12 T A 18: 37,436,015 D71E probably benign Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,499,669 probably null Het
Pkm A G 9: 59,668,913 S127G probably benign Het
Plxna2 T A 1: 194,796,919 L1296H probably damaging Het
Ppil6 C G 10: 41,498,528 T135R probably benign Het
Ppp2r3a T C 9: 101,127,004 Y378C probably damaging Het
Rabep2 C T 7: 126,444,205 R426C probably damaging Het
Rad21 A T 15: 51,982,580 H31Q possibly damaging Het
Rad50 G T 11: 53,654,949 Y1182* probably null Het
Serpinb9c C T 13: 33,151,900 A218T possibly damaging Het
Slc17a2 C A 13: 23,819,112 H248Q probably benign Het
Slc45a4 C A 15: 73,586,936 E255* probably null Het
Slc8a3 T A 12: 81,216,824 K596N possibly damaging Het
Tbc1d32 A C 10: 56,051,387 probably null Het
Tbl2 T A 5: 135,154,399 I112N possibly damaging Het
Tchp A C 5: 114,715,569 K238T probably damaging Het
Tfap2d G A 1: 19,118,983 G251D probably damaging Het
Thrb T A 14: 18,030,186 M324K probably damaging Het
Tmem259 A T 10: 79,978,466 L328Q probably damaging Het
Tmtc2 T C 10: 105,413,608 H88R probably damaging Het
Tnfrsf21 A G 17: 43,037,818 H107R possibly damaging Het
Trib1 T C 15: 59,654,622 V347A probably benign Het
Ung T A 5: 114,131,254 L9* probably null Het
Vmn1r195 G T 13: 22,279,004 V215F probably damaging Het
Wdr63 T C 3: 146,081,252 T343A probably damaging Het
Wdr90 A G 17: 25,846,312 S1657P probably benign Het
Wdsub1 A T 2: 59,878,143 Y129N possibly damaging Het
Zfp369 T G 13: 65,285,018 probably null Het
Zfp770 G T 2: 114,195,661 C642* probably null Het
Zfp981 C T 4: 146,537,643 R342C probably benign Het
Zhx3 A C 2: 160,781,122 V375G probably damaging Het
Other mutations in Akt1s1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0173:Akt1s1 UTSW 7 44852860 missense possibly damaging 0.93
R0645:Akt1s1 UTSW 7 44849221 unclassified probably benign
R3894:Akt1s1 UTSW 7 44853939 missense probably damaging 1.00
R4378:Akt1s1 UTSW 7 44853960 missense probably damaging 1.00
R5068:Akt1s1 UTSW 7 44850008 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CGAGGTTGTTAAGGCTGCAG -3'
(R):5'- AGAAATTTGGGGCAGCTTCG -3'

Sequencing Primer
(F):5'- TGCAGTGGGTGAGACCATC -3'
(R):5'- AGCTTCGTTTCCAGGAGCAC -3'
Posted On2019-06-26