Incidental Mutation 'R7288:Pkm'
ID566165
Institutional Source Beutler Lab
Gene Symbol Pkm
Ensembl Gene ENSMUSG00000032294
Gene Namepyruvate kinase, muscle
SynonymsPkm2, Pk-3, Pk-2, Pk3
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7288 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location59656368-59679375 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 59668913 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 127 (S127G)
Ref Sequence ENSEMBL: ENSMUSP00000034834 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034834] [ENSMUST00000163694] [ENSMUST00000213930] [ENSMUST00000215623] [ENSMUST00000215660] [ENSMUST00000216620] [ENSMUST00000216857] [ENSMUST00000217038] [ENSMUST00000217353]
Predicted Effect probably benign
Transcript: ENSMUST00000034834
AA Change: S127G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000034834
Gene: ENSMUSG00000032294
AA Change: S127G

DomainStartEndE-ValueType
Pfam:PK 42 395 1.3e-172 PFAM
Pfam:PK_C 409 529 3.1e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163694
AA Change: S127G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000128770
Gene: ENSMUSG00000032294
AA Change: S127G

DomainStartEndE-ValueType
Pfam:PK 42 395 2.6e-174 PFAM
Pfam:PK_C 410 528 1.9e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213930
AA Change: S127G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000215623
AA Change: S127G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000215660
AA Change: S127G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000216620
Predicted Effect probably benign
Transcript: ENSMUST00000216857
Predicted Effect probably benign
Transcript: ENSMUST00000217038
AA Change: S127G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000217353
AA Change: S127G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein involved in glycolysis. The encoded protein is a pyruvate kinase that catalyzes the transfer of a phosphoryl group from phosphoenolpyruvate to ADP, generating ATP and pyruvate. This protein has been shown to interact with thyroid hormone and may mediate cellular metabolic effects induced by thyroid hormones. This protein has been found to bind Opa protein, a bacterial outer membrane protein involved in gonococcal adherence to and invasion of human cells, suggesting a role of this protein in bacterial pathogenesis. Several alternatively spliced transcript variants encoding a few distinct isoforms have been reported. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for a spontaneous allele exhibit prenatal lethality around the time of implanatation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik T A 11: 58,880,305 D204E probably benign Het
Adh1 T G 3: 138,282,732 D155E probably benign Het
Akt1s1 T C 7: 44,849,147 L2P unknown Het
Ash1l T A 3: 88,965,892 probably benign Het
Bend7 C T 2: 4,752,830 P228S probably damaging Het
Bpifc T C 10: 85,988,721 E218G possibly damaging Het
Cdk6 T A 5: 3,429,001 F127Y probably benign Het
Cgnl1 A T 9: 71,725,564 H168Q possibly damaging Het
Chd7 C T 4: 8,847,093 T1612I possibly damaging Het
Col4a4 A T 1: 82,492,463 C782S unknown Het
Copg2 T A 6: 30,824,406 I364L probably damaging Het
Crygb A G 1: 65,081,925 L81P probably benign Het
Cyp4f18 A T 8: 71,993,173 M326K probably damaging Het
Dhx34 A G 7: 16,215,436 S356P probably benign Het
Dmbt1 C T 7: 131,083,789 Q855* probably null Het
Dnph1 A G 17: 46,499,012 N160S probably benign Het
Esrra A T 19: 6,912,771 C228* probably null Het
Evpl T C 11: 116,223,949 N972D probably benign Het
Fat3 T C 9: 15,998,592 D2038G probably damaging Het
Fhit T A 14: 9,763,784 R102W probably damaging Het
Gal3st1 A T 11: 3,998,609 D272V probably damaging Het
Gal3st1 T A 11: 3,998,651 V286D probably damaging Het
Gemin4 A T 11: 76,213,380 M185K possibly damaging Het
Hecw1 T C 13: 14,316,236 I311V probably benign Het
Ift172 T C 5: 31,285,286 Y179C probably damaging Het
Ighv7-3 C T 12: 114,153,343 W66* probably null Het
Iqgap3 T A 3: 88,108,835 I975N probably damaging Het
Khdrbs3 A G 15: 69,049,413 E281G possibly damaging Het
Lamb2 A T 9: 108,488,324 T1369S probably benign Het
Mettl8 A T 2: 70,982,038 D84E probably benign Het
Mrgprb3 C A 7: 48,643,311 C164F probably damaging Het
Mtg2 A G 2: 180,083,387 Y131C probably damaging Het
Nacc1 C T 8: 84,676,545 A234T probably benign Het
Nsmaf C T 4: 6,416,641 V551I probably benign Het
Olfr541 T A 7: 140,705,029 C259* probably null Het
Olfr869 T A 9: 20,137,441 Y108* probably null Het
Oxr1 C T 15: 41,813,608 P187L not run Het
Pcdhb12 T A 18: 37,436,015 D71E probably benign Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,499,669 probably null Het
Plxna2 T A 1: 194,796,919 L1296H probably damaging Het
Ppil6 C G 10: 41,498,528 T135R probably benign Het
Ppp2r3a T C 9: 101,127,004 Y378C probably damaging Het
Rabep2 C T 7: 126,444,205 R426C probably damaging Het
Rad21 A T 15: 51,982,580 H31Q possibly damaging Het
Rad50 G T 11: 53,654,949 Y1182* probably null Het
Serpinb9c C T 13: 33,151,900 A218T possibly damaging Het
Slc17a2 C A 13: 23,819,112 H248Q probably benign Het
Slc45a4 C A 15: 73,586,936 E255* probably null Het
Slc8a3 T A 12: 81,216,824 K596N possibly damaging Het
Tbc1d32 A C 10: 56,051,387 probably null Het
Tbl2 T A 5: 135,154,399 I112N possibly damaging Het
Tchp A C 5: 114,715,569 K238T probably damaging Het
Tfap2d G A 1: 19,118,983 G251D probably damaging Het
Thrb T A 14: 18,030,186 M324K probably damaging Het
Tmem259 A T 10: 79,978,466 L328Q probably damaging Het
Tmtc2 T C 10: 105,413,608 H88R probably damaging Het
Tnfrsf21 A G 17: 43,037,818 H107R possibly damaging Het
Trib1 T C 15: 59,654,622 V347A probably benign Het
Ung T A 5: 114,131,254 L9* probably null Het
Vmn1r195 G T 13: 22,279,004 V215F probably damaging Het
Wdr63 T C 3: 146,081,252 T343A probably damaging Het
Wdr90 A G 17: 25,846,312 S1657P probably benign Het
Wdsub1 A T 2: 59,878,143 Y129N possibly damaging Het
Zfp369 T G 13: 65,285,018 probably null Het
Zfp770 G T 2: 114,195,661 C642* probably null Het
Zfp981 C T 4: 146,537,643 R342C probably benign Het
Zhx3 A C 2: 160,781,122 V375G probably damaging Het
Other mutations in Pkm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01693:Pkm APN 9 59670522 missense probably damaging 1.00
IGL02014:Pkm APN 9 59668961 missense possibly damaging 0.59
IGL02054:Pkm APN 9 59678201 missense probably damaging 1.00
negligible UTSW 9 59670634 missense probably damaging 1.00
R0087:Pkm UTSW 9 59678099 nonsense probably null
R0603:Pkm UTSW 9 59665881 missense probably damaging 0.97
R0940:Pkm UTSW 9 59668535 splice site probably benign
R0990:Pkm UTSW 9 59678096 missense probably damaging 1.00
R1446:Pkm UTSW 9 59668910 splice site probably null
R5104:Pkm UTSW 9 59668681 critical splice donor site probably null
R5369:Pkm UTSW 9 59670634 missense probably damaging 1.00
R6831:Pkm UTSW 9 59675115 missense probably benign
R6974:Pkm UTSW 9 59668570 missense probably damaging 0.99
R7169:Pkm UTSW 9 59671625 missense possibly damaging 0.95
R7621:Pkm UTSW 9 59678158 nonsense probably null
R7844:Pkm UTSW 9 59670722 missense probably benign 0.00
R8217:Pkm UTSW 9 59678809 missense possibly damaging 0.74
R8234:Pkm UTSW 9 59670599 missense possibly damaging 0.87
R8301:Pkm UTSW 9 59668631 missense probably damaging 0.99
R8313:Pkm UTSW 9 59668619 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TTAGTCTCACTCTGGGAAACG -3'
(R):5'- ATTCGAGGTCTGTGCTTGCC -3'

Sequencing Primer
(F):5'- CTCACTCTGGGAAACGGGTATTTTG -3'
(R):5'- GGACTGTGTACCAGACATACCTTTC -3'
Posted On2019-06-26