Incidental Mutation 'R7288:Cgnl1'
ID566166
Institutional Source Beutler Lab
Gene Symbol Cgnl1
Ensembl Gene ENSMUSG00000032232
Gene Namecingulin-like 1
SynonymsJacop, 9930020M10Rik, 4933421H10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7288 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location71626509-71771602 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 71725564 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 168 (H168Q)
Ref Sequence ENSEMBL: ENSMUSP00000112479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072899] [ENSMUST00000121322] [ENSMUST00000122065]
Predicted Effect possibly damaging
Transcript: ENSMUST00000072899
AA Change: H168Q

PolyPhen 2 Score 0.672 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000072672
Gene: ENSMUSG00000032232
AA Change: H168Q

DomainStartEndE-ValueType
low complexity region 292 309 N/A INTRINSIC
low complexity region 539 550 N/A INTRINSIC
low complexity region 615 634 N/A INTRINSIC
low complexity region 638 653 N/A INTRINSIC
low complexity region 728 739 N/A INTRINSIC
Pfam:Myosin_tail_1 984 1255 5.4e-30 PFAM
low complexity region 1258 1278 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000121322
AA Change: H168Q

PolyPhen 2 Score 0.672 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000113917
Gene: ENSMUSG00000032232
AA Change: H168Q

DomainStartEndE-ValueType
low complexity region 292 309 N/A INTRINSIC
low complexity region 539 550 N/A INTRINSIC
low complexity region 615 634 N/A INTRINSIC
low complexity region 638 653 N/A INTRINSIC
Pfam:Myosin_tail_1 909 1184 2.3e-30 PFAM
low complexity region 1187 1207 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000122065
AA Change: H168Q

PolyPhen 2 Score 0.672 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000112479
Gene: ENSMUSG00000032232
AA Change: H168Q

DomainStartEndE-ValueType
low complexity region 292 309 N/A INTRINSIC
low complexity region 539 550 N/A INTRINSIC
Pfam:Myosin_tail_1 582 1034 1.3e-12 PFAM
Pfam:Myosin_tail_1 1011 1253 7.7e-38 PFAM
low complexity region 1258 1278 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein localized to the tight junctions and adherens junctions in vertebrate epithelial cells. The encoded protein regulates the activity of Rho family GTPases during junction assembly and at confluence. At the adherens junctions, the encoded protein is part of a protein complex that links E-cadherin to the microtubule cytoskeleton. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik T A 11: 58,880,305 D204E probably benign Het
Adh1 T G 3: 138,282,732 D155E probably benign Het
Akt1s1 T C 7: 44,849,147 L2P unknown Het
Ash1l T A 3: 88,965,892 probably benign Het
Bend7 C T 2: 4,752,830 P228S probably damaging Het
Bpifc T C 10: 85,988,721 E218G possibly damaging Het
Cdk6 T A 5: 3,429,001 F127Y probably benign Het
Chd7 C T 4: 8,847,093 T1612I possibly damaging Het
Col4a4 A T 1: 82,492,463 C782S unknown Het
Copg2 T A 6: 30,824,406 I364L probably damaging Het
Crygb A G 1: 65,081,925 L81P probably benign Het
Cyp4f18 A T 8: 71,993,173 M326K probably damaging Het
Dhx34 A G 7: 16,215,436 S356P probably benign Het
Dmbt1 C T 7: 131,083,789 Q855* probably null Het
Dnph1 A G 17: 46,499,012 N160S probably benign Het
Esrra A T 19: 6,912,771 C228* probably null Het
Evpl T C 11: 116,223,949 N972D probably benign Het
Fat3 T C 9: 15,998,592 D2038G probably damaging Het
Fhit T A 14: 9,763,784 R102W probably damaging Het
Gal3st1 A T 11: 3,998,609 D272V probably damaging Het
Gal3st1 T A 11: 3,998,651 V286D probably damaging Het
Gemin4 A T 11: 76,213,380 M185K possibly damaging Het
Hecw1 T C 13: 14,316,236 I311V probably benign Het
Ift172 T C 5: 31,285,286 Y179C probably damaging Het
Ighv7-3 C T 12: 114,153,343 W66* probably null Het
Iqgap3 T A 3: 88,108,835 I975N probably damaging Het
Khdrbs3 A G 15: 69,049,413 E281G possibly damaging Het
Lamb2 A T 9: 108,488,324 T1369S probably benign Het
Mettl8 A T 2: 70,982,038 D84E probably benign Het
Mrgprb3 C A 7: 48,643,311 C164F probably damaging Het
Mtg2 A G 2: 180,083,387 Y131C probably damaging Het
Nacc1 C T 8: 84,676,545 A234T probably benign Het
Nsmaf C T 4: 6,416,641 V551I probably benign Het
Olfr541 T A 7: 140,705,029 C259* probably null Het
Olfr869 T A 9: 20,137,441 Y108* probably null Het
Oxr1 C T 15: 41,813,608 P187L not run Het
Pcdhb12 T A 18: 37,436,015 D71E probably benign Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,499,669 probably null Het
Pkm A G 9: 59,668,913 S127G probably benign Het
Plxna2 T A 1: 194,796,919 L1296H probably damaging Het
Ppil6 C G 10: 41,498,528 T135R probably benign Het
Ppp2r3a T C 9: 101,127,004 Y378C probably damaging Het
Rabep2 C T 7: 126,444,205 R426C probably damaging Het
Rad21 A T 15: 51,982,580 H31Q possibly damaging Het
Rad50 G T 11: 53,654,949 Y1182* probably null Het
Serpinb9c C T 13: 33,151,900 A218T possibly damaging Het
Slc17a2 C A 13: 23,819,112 H248Q probably benign Het
Slc45a4 C A 15: 73,586,936 E255* probably null Het
Slc8a3 T A 12: 81,216,824 K596N possibly damaging Het
Tbc1d32 A C 10: 56,051,387 probably null Het
Tbl2 T A 5: 135,154,399 I112N possibly damaging Het
Tchp A C 5: 114,715,569 K238T probably damaging Het
Tfap2d G A 1: 19,118,983 G251D probably damaging Het
Thrb T A 14: 18,030,186 M324K probably damaging Het
Tmem259 A T 10: 79,978,466 L328Q probably damaging Het
Tmtc2 T C 10: 105,413,608 H88R probably damaging Het
Tnfrsf21 A G 17: 43,037,818 H107R possibly damaging Het
Trib1 T C 15: 59,654,622 V347A probably benign Het
Ung T A 5: 114,131,254 L9* probably null Het
Vmn1r195 G T 13: 22,279,004 V215F probably damaging Het
Wdr63 T C 3: 146,081,252 T343A probably damaging Het
Wdr90 A G 17: 25,846,312 S1657P probably benign Het
Wdsub1 A T 2: 59,878,143 Y129N possibly damaging Het
Zfp369 T G 13: 65,285,018 probably null Het
Zfp770 G T 2: 114,195,661 C642* probably null Het
Zfp981 C T 4: 146,537,643 R342C probably benign Het
Zhx3 A C 2: 160,781,122 V375G probably damaging Het
Other mutations in Cgnl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00556:Cgnl1 APN 9 71656056 missense probably benign 0.00
IGL01128:Cgnl1 APN 9 71724561 missense possibly damaging 0.81
IGL01450:Cgnl1 APN 9 71631862 splice site probably benign
IGL01788:Cgnl1 APN 9 71655390 missense probably benign
IGL01806:Cgnl1 APN 9 71650322 missense probably damaging 0.99
IGL01906:Cgnl1 APN 9 71724567 missense probably benign 0.00
IGL01933:Cgnl1 APN 9 71645483 splice site probably benign
IGL01939:Cgnl1 APN 9 71725004 missense probably damaging 1.00
IGL01947:Cgnl1 APN 9 71725044 missense probably damaging 0.99
IGL02127:Cgnl1 APN 9 71725853 missense probably damaging 1.00
IGL02379:Cgnl1 APN 9 71645553 missense possibly damaging 0.82
IGL02510:Cgnl1 APN 9 71725357 missense probably benign 0.41
FR4548:Cgnl1 UTSW 9 71724717 small insertion probably benign
R0058:Cgnl1 UTSW 9 71641397 missense probably damaging 1.00
R0058:Cgnl1 UTSW 9 71724840 missense probably damaging 0.99
R0105:Cgnl1 UTSW 9 71656102 missense probably benign
R0220:Cgnl1 UTSW 9 71724943 missense possibly damaging 0.68
R0242:Cgnl1 UTSW 9 71721657 missense probably damaging 1.00
R0401:Cgnl1 UTSW 9 71705239 missense probably damaging 1.00
R0541:Cgnl1 UTSW 9 71651253 missense possibly damaging 0.54
R1018:Cgnl1 UTSW 9 71726058 missense probably damaging 1.00
R1026:Cgnl1 UTSW 9 71717431 missense possibly damaging 0.91
R1056:Cgnl1 UTSW 9 71725895 missense probably damaging 1.00
R1299:Cgnl1 UTSW 9 71721712 splice site probably benign
R1513:Cgnl1 UTSW 9 71724590 missense probably benign 0.02
R1546:Cgnl1 UTSW 9 71725815 missense probably benign
R1599:Cgnl1 UTSW 9 71641427 missense probably benign 0.02
R1657:Cgnl1 UTSW 9 71725944 missense probably damaging 0.98
R1970:Cgnl1 UTSW 9 71725535 missense probably benign 0.10
R2004:Cgnl1 UTSW 9 71630539 missense probably damaging 1.00
R2080:Cgnl1 UTSW 9 71656096 missense probably benign 0.01
R2085:Cgnl1 UTSW 9 71630878 missense probably damaging 1.00
R2357:Cgnl1 UTSW 9 71725668 nonsense probably null
R2402:Cgnl1 UTSW 9 71725179 missense probably damaging 1.00
R3954:Cgnl1 UTSW 9 71724663 missense probably benign 0.01
R4043:Cgnl1 UTSW 9 71705293 missense probably damaging 1.00
R4127:Cgnl1 UTSW 9 71724540 missense probably benign 0.00
R4825:Cgnl1 UTSW 9 71630524 missense probably benign 0.00
R4851:Cgnl1 UTSW 9 71725032 missense probably damaging 1.00
R4882:Cgnl1 UTSW 9 71717401 missense probably benign 0.00
R4996:Cgnl1 UTSW 9 71724826 small deletion probably benign
R5057:Cgnl1 UTSW 9 71724794 missense probably damaging 0.99
R5263:Cgnl1 UTSW 9 71632654 nonsense probably null
R5402:Cgnl1 UTSW 9 71629321 missense probably damaging 1.00
R5744:Cgnl1 UTSW 9 71630675 splice site probably null
R5770:Cgnl1 UTSW 9 71645487 splice site probably null
R6911:Cgnl1 UTSW 9 71656215 missense possibly damaging 0.82
R7014:Cgnl1 UTSW 9 71725134 missense possibly damaging 0.86
R7106:Cgnl1 UTSW 9 71725733 missense probably benign 0.00
R7203:Cgnl1 UTSW 9 71724533 missense possibly damaging 0.80
R7231:Cgnl1 UTSW 9 71632645 missense probably benign 0.39
R7241:Cgnl1 UTSW 9 71724770 missense probably benign
R7327:Cgnl1 UTSW 9 71725883 missense possibly damaging 0.48
R7390:Cgnl1 UTSW 9 71645649 missense probably benign 0.04
R7529:Cgnl1 UTSW 9 71631758 missense probably damaging 1.00
R7793:Cgnl1 UTSW 9 71725635 missense probably damaging 1.00
R7975:Cgnl1 UTSW 9 71725322 missense probably benign 0.00
R7990:Cgnl1 UTSW 9 71725265 missense probably damaging 1.00
RF015:Cgnl1 UTSW 9 71724715 small insertion probably benign
RF042:Cgnl1 UTSW 9 71724715 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- TTCACGCACACTGAGGTCTG -3'
(R):5'- TTCCAGAAAACCCGTACCTG -3'

Sequencing Primer
(F):5'- CGCACACTGAGGTCTGCTTTTG -3'
(R):5'- TGCAAACCAGCCCGCTAAG -3'
Posted On2019-06-26