Incidental Mutation 'R7288:Lamb2'
ID566168
Institutional Source Beutler Lab
Gene Symbol Lamb2
Ensembl Gene ENSMUSG00000052911
Gene Namelaminin, beta 2
SynonymsLams, npht, Lamb-2
Accession Numbers

Genbank: NM_008483; MGI: 99916

Is this an essential gene? Probably essential (E-score: 0.817) question?
Stock #R7288 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location108479736-108490530 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 108488324 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 1369 (T1369S)
Ref Sequence ENSEMBL: ENSMUSP00000069087 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006854] [ENSMUST00000065014] [ENSMUST00000085044] [ENSMUST00000166103] [ENSMUST00000178075] [ENSMUST00000193678]
Predicted Effect probably benign
Transcript: ENSMUST00000006854
SMART Domains Protein: ENSMUSP00000006854
Gene: ENSMUSG00000006676

DomainStartEndE-ValueType
Pfam:CS 55 129 1.3e-6 PFAM
low complexity region 257 268 N/A INTRINSIC
Pfam:CS 326 414 7.1e-19 PFAM
Pfam:USP19_linker 415 537 2.2e-61 PFAM
Pfam:UCH 538 1253 1.2e-77 PFAM
Pfam:UCH_1 539 874 8.6e-11 PFAM
Pfam:zf-MYND 833 875 9.9e-11 PFAM
Pfam:UCH_1 1021 1235 7.1e-10 PFAM
low complexity region 1278 1287 N/A INTRINSIC
low complexity region 1301 1312 N/A INTRINSIC
transmembrane domain 1333 1355 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000065014
AA Change: T1369S

PolyPhen 2 Score 0.201 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000069087
Gene: ENSMUSG00000052911
AA Change: T1369S

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
LamNT 44 284 1.9e-102 SMART
EGF_Lam 286 347 1.34e-6 SMART
EGF_Lam 350 410 6.1e-10 SMART
EGF_Lam 413 470 2.98e-13 SMART
EGF_Lam 473 522 7.93e-9 SMART
EGF_Lam 525 569 1.01e-10 SMART
EGF_Lam 784 829 3.42e-13 SMART
EGF_Lam 832 875 6.54e-10 SMART
EGF_Lam 878 925 1.34e-6 SMART
EGF_Lam 928 984 4.74e-7 SMART
EGF_Lam 987 1036 1.53e-10 SMART
EGF_Lam 1039 1093 6.29e-12 SMART
EGF_Lam 1096 1141 1.79e-7 SMART
EGF_Lam 1144 1188 6.64e-11 SMART
coiled coil region 1261 1299 N/A INTRINSIC
low complexity region 1445 1458 N/A INTRINSIC
coiled coil region 1473 1527 N/A INTRINSIC
low complexity region 1609 1625 N/A INTRINSIC
SCOP:d1eq1a_ 1632 1786 5e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000085044
SMART Domains Protein: ENSMUSP00000082119
Gene: ENSMUSG00000006676

DomainStartEndE-ValueType
Pfam:CS 55 129 4.7e-7 PFAM
low complexity region 257 268 N/A INTRINSIC
Pfam:CS 326 414 2.5e-15 PFAM
low complexity region 449 460 N/A INTRINSIC
low complexity region 524 530 N/A INTRINSIC
Pfam:UCH 538 1253 7.4e-84 PFAM
Pfam:UCH_1 539 879 2.3e-13 PFAM
Pfam:zf-MYND 833 875 2.4e-10 PFAM
Pfam:UCH_1 1020 1235 2.9e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166103
SMART Domains Protein: ENSMUSP00000128573
Gene: ENSMUSG00000006676

DomainStartEndE-ValueType
Pfam:CS 55 129 2.6e-7 PFAM
low complexity region 257 268 N/A INTRINSIC
Pfam:CS 326 390 3.9e-9 PFAM
low complexity region 425 436 N/A INTRINSIC
low complexity region 500 506 N/A INTRINSIC
Pfam:UCH 514 1229 1.8e-84 PFAM
Pfam:UCH_1 515 855 5.5e-14 PFAM
Pfam:zf-MYND 809 851 1.7e-10 PFAM
Pfam:UCH_1 996 1211 6.9e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178075
SMART Domains Protein: ENSMUSP00000135930
Gene: ENSMUSG00000006676

DomainStartEndE-ValueType
Pfam:CS 55 129 1e-6 PFAM
low complexity region 258 269 N/A INTRINSIC
Pfam:CS 327 415 5.4e-15 PFAM
low complexity region 450 461 N/A INTRINSIC
low complexity region 525 531 N/A INTRINSIC
Pfam:UCH 539 1254 4.9e-84 PFAM
Pfam:UCH_1 540 880 1.4e-13 PFAM
Pfam:zf-MYND 834 876 5.2e-10 PFAM
Pfam:UCH_1 1021 1236 1.8e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193678
SMART Domains Protein: ENSMUSP00000141738
Gene: ENSMUSG00000006676

DomainStartEndE-ValueType
Pfam:CS 55 129 6.8e-7 PFAM
low complexity region 258 269 N/A INTRINSIC
Pfam:CS 327 415 3.6e-15 PFAM
low complexity region 448 459 N/A INTRINSIC
low complexity region 523 529 N/A INTRINSIC
Pfam:UCH 537 1252 3.8e-84 PFAM
Pfam:UCH_1 538 878 1.1e-13 PFAM
Pfam:zf-MYND 832 874 5.1e-10 PFAM
Pfam:UCH_1 1019 1234 1.4e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype Strain: 2138070
Lethality: D1-D30
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins, composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively), form a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the beta chain isoform laminin, beta 2. The beta 2 chain contains the 7 structural domains typical of beta chains of laminin, including the short alpha region. However, unlike beta 1 chain, beta 2 has a more restricted tissue distribution. It is enriched in the basement membrane of muscles at the neuromuscular junctions, kidney glomerulus and vascular smooth muscle. Transgenic mice in which the beta 2 chain gene was inactivated by homologous recombination, showed defects in the maturation of neuromuscular junctions and impairment of glomerular filtration. Alternative splicing involving a non consensus 5' splice site (gc) in the 5' UTR of this gene has been reported. It was suggested that inefficient splicing of this first intron, which does not change the protein sequence, results in a greater abundance of the unspliced form of the transcript than the spliced form. The full-length nature of the spliced transcript is not known. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit small size, severe proteinuria due to a defect in glomerular filtration, abnormalities of the retina and skeletal neuromuscular synapses, and lethality by 30 days of age. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, knock-out(2) Gene trapped(3)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik T A 11: 58,880,305 D204E probably benign Het
Adh1 T G 3: 138,282,732 D155E probably benign Het
Akt1s1 T C 7: 44,849,147 L2P unknown Het
Ash1l T A 3: 88,965,892 probably benign Het
Bend7 C T 2: 4,752,830 P228S probably damaging Het
Bpifc T C 10: 85,988,721 E218G possibly damaging Het
Cdk6 T A 5: 3,429,001 F127Y probably benign Het
Cgnl1 A T 9: 71,725,564 H168Q possibly damaging Het
Chd7 C T 4: 8,847,093 T1612I possibly damaging Het
Col4a4 A T 1: 82,492,463 C782S unknown Het
Copg2 T A 6: 30,824,406 I364L probably damaging Het
Crygb A G 1: 65,081,925 L81P probably benign Het
Cyp4f18 A T 8: 71,993,173 M326K probably damaging Het
Dhx34 A G 7: 16,215,436 S356P probably benign Het
Dmbt1 C T 7: 131,083,789 Q855* probably null Het
Dnph1 A G 17: 46,499,012 N160S probably benign Het
Esrra A T 19: 6,912,771 C228* probably null Het
Evpl T C 11: 116,223,949 N972D probably benign Het
Fat3 T C 9: 15,998,592 D2038G probably damaging Het
Fhit T A 14: 9,763,784 R102W probably damaging Het
Gal3st1 A T 11: 3,998,609 D272V probably damaging Het
Gal3st1 T A 11: 3,998,651 V286D probably damaging Het
Gemin4 A T 11: 76,213,380 M185K possibly damaging Het
Hecw1 T C 13: 14,316,236 I311V probably benign Het
Ift172 T C 5: 31,285,286 Y179C probably damaging Het
Ighv7-3 C T 12: 114,153,343 W66* probably null Het
Iqgap3 T A 3: 88,108,835 I975N probably damaging Het
Khdrbs3 A G 15: 69,049,413 E281G possibly damaging Het
Mettl8 A T 2: 70,982,038 D84E probably benign Het
Mrgprb3 C A 7: 48,643,311 C164F probably damaging Het
Mtg2 A G 2: 180,083,387 Y131C probably damaging Het
Nacc1 C T 8: 84,676,545 A234T probably benign Het
Nsmaf C T 4: 6,416,641 V551I probably benign Het
Olfr541 T A 7: 140,705,029 C259* probably null Het
Olfr869 T A 9: 20,137,441 Y108* probably null Het
Oxr1 C T 15: 41,813,608 P187L not run Het
Pcdhb12 T A 18: 37,436,015 D71E probably benign Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,499,669 probably null Het
Pkm A G 9: 59,668,913 S127G probably benign Het
Plxna2 T A 1: 194,796,919 L1296H probably damaging Het
Ppil6 C G 10: 41,498,528 T135R probably benign Het
Ppp2r3a T C 9: 101,127,004 Y378C probably damaging Het
Rabep2 C T 7: 126,444,205 R426C probably damaging Het
Rad21 A T 15: 51,982,580 H31Q possibly damaging Het
Rad50 G T 11: 53,654,949 Y1182* probably null Het
Serpinb9c C T 13: 33,151,900 A218T possibly damaging Het
Slc17a2 C A 13: 23,819,112 H248Q probably benign Het
Slc45a4 C A 15: 73,586,936 E255* probably null Het
Slc8a3 T A 12: 81,216,824 K596N possibly damaging Het
Tbc1d32 A C 10: 56,051,387 probably null Het
Tbl2 T A 5: 135,154,399 I112N possibly damaging Het
Tchp A C 5: 114,715,569 K238T probably damaging Het
Tfap2d G A 1: 19,118,983 G251D probably damaging Het
Thrb T A 14: 18,030,186 M324K probably damaging Het
Tmem259 A T 10: 79,978,466 L328Q probably damaging Het
Tmtc2 T C 10: 105,413,608 H88R probably damaging Het
Tnfrsf21 A G 17: 43,037,818 H107R possibly damaging Het
Trib1 T C 15: 59,654,622 V347A probably benign Het
Ung T A 5: 114,131,254 L9* probably null Het
Vmn1r195 G T 13: 22,279,004 V215F probably damaging Het
Wdr63 T C 3: 146,081,252 T343A probably damaging Het
Wdr90 A G 17: 25,846,312 S1657P probably benign Het
Wdsub1 A T 2: 59,878,143 Y129N possibly damaging Het
Zfp369 T G 13: 65,285,018 probably null Het
Zfp770 G T 2: 114,195,661 C642* probably null Het
Zfp981 C T 4: 146,537,643 R342C probably benign Het
Zhx3 A C 2: 160,781,122 V375G probably damaging Het
Other mutations in Lamb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01370:Lamb2 APN 9 108487733 unclassified probably null
IGL02072:Lamb2 APN 9 108481908 nonsense probably null
IGL02079:Lamb2 APN 9 108482113 missense probably damaging 1.00
IGL02087:Lamb2 APN 9 108487119 missense possibly damaging 0.95
IGL02193:Lamb2 APN 9 108489360 missense probably benign 0.00
IGL02199:Lamb2 APN 9 108480625 missense possibly damaging 0.49
IGL02201:Lamb2 APN 9 108487542 missense probably damaging 1.00
IGL02468:Lamb2 APN 9 108487149 missense probably damaging 1.00
F6893:Lamb2 UTSW 9 108482556 missense probably benign 0.12
R0053:Lamb2 UTSW 9 108486737 nonsense probably null
R0053:Lamb2 UTSW 9 108486737 nonsense probably null
R0122:Lamb2 UTSW 9 108486514 missense probably benign 0.01
R0452:Lamb2 UTSW 9 108486354 unclassified probably benign
R0524:Lamb2 UTSW 9 108484372 missense possibly damaging 0.90
R0605:Lamb2 UTSW 9 108486105 unclassified probably benign
R0737:Lamb2 UTSW 9 108483794 missense probably benign 0.03
R1083:Lamb2 UTSW 9 108483693 missense probably benign
R1159:Lamb2 UTSW 9 108481408 missense probably damaging 1.00
R1283:Lamb2 UTSW 9 108481808 missense possibly damaging 0.46
R1507:Lamb2 UTSW 9 108490382 missense probably damaging 1.00
R1547:Lamb2 UTSW 9 108482625 missense probably benign 0.00
R1576:Lamb2 UTSW 9 108480307 missense probably damaging 0.96
R1647:Lamb2 UTSW 9 108481423 critical splice donor site probably null
R1678:Lamb2 UTSW 9 108483686 critical splice acceptor site probably null
R1740:Lamb2 UTSW 9 108481928 missense probably damaging 1.00
R1803:Lamb2 UTSW 9 108488099 missense probably benign
R1846:Lamb2 UTSW 9 108487387 missense probably benign 0.00
R1863:Lamb2 UTSW 9 108481384 missense probably benign 0.13
R2184:Lamb2 UTSW 9 108480553 missense probably damaging 1.00
R2262:Lamb2 UTSW 9 108480610 missense probably damaging 1.00
R2338:Lamb2 UTSW 9 108482141 missense probably benign 0.20
R2483:Lamb2 UTSW 9 108480559 missense probably damaging 1.00
R4084:Lamb2 UTSW 9 108488018 missense probably benign 0.17
R4164:Lamb2 UTSW 9 108490298 missense probably damaging 1.00
R4295:Lamb2 UTSW 9 108486211 missense probably benign 0.42
R4422:Lamb2 UTSW 9 108483555 missense probably damaging 0.99
R4497:Lamb2 UTSW 9 108486798 missense probably damaging 1.00
R4880:Lamb2 UTSW 9 108484027 unclassified probably null
R4935:Lamb2 UTSW 9 108487501 missense possibly damaging 0.93
R4977:Lamb2 UTSW 9 108487647 missense probably damaging 0.99
R5152:Lamb2 UTSW 9 108487738 missense probably benign
R5499:Lamb2 UTSW 9 108487802 missense possibly damaging 0.50
R5724:Lamb2 UTSW 9 108480751 splice site probably null
R5932:Lamb2 UTSW 9 108480611 missense probably damaging 1.00
R5997:Lamb2 UTSW 9 108480388 missense possibly damaging 0.65
R6052:Lamb2 UTSW 9 108487612 nonsense probably null
R6142:Lamb2 UTSW 9 108485618 nonsense probably null
R6245:Lamb2 UTSW 9 108488199 splice site probably null
R6531:Lamb2 UTSW 9 108483726 missense possibly damaging 0.78
R6557:Lamb2 UTSW 9 108488400 missense probably damaging 1.00
R6562:Lamb2 UTSW 9 108487008 missense possibly damaging 0.56
R6997:Lamb2 UTSW 9 108481297 missense probably damaging 1.00
R7024:Lamb2 UTSW 9 108489488 missense probably benign 0.00
R7116:Lamb2 UTSW 9 108487323 missense probably damaging 1.00
R7146:Lamb2 UTSW 9 108484084 missense possibly damaging 0.94
R7261:Lamb2 UTSW 9 108481297 missense probably damaging 1.00
R7404:Lamb2 UTSW 9 108487583 missense probably damaging 1.00
R7456:Lamb2 UTSW 9 108485780 missense possibly damaging 0.95
R7472:Lamb2 UTSW 9 108486148 missense probably benign 0.01
R7623:Lamb2 UTSW 9 108489224 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- TCAGCATCTGGAGATCCTCAAAC -3'
(R):5'- CAAGGTCCTGTGGGAAGAACAC -3'

Sequencing Primer
(F):5'- CATTCAAATTTCTTAGGTGAGTTGC -3'
(R):5'- GGGAAGAACACCCACACC -3'
Posted On2019-06-26