Mutagenetix > Incidental Mutation

Incidental Mutation 'R7288:Slc8a3'

566180

Institutional Source

Beutler Lab

Gene Symbol

Slc8a3

Ensembl Gene

ENSMUSG00000079055

Gene Name

solute carrier family 8 (sodium/calcium exchanger), member 3

Synonyms

Ncx3

MMRRC Submission

045395-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7288 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

81197915-81333180 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 81216824 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Asparagine at position 596 (K596N)

Ref Sequence

ENSEMBL: ENSMUSP00000138735 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064594] [ENSMUST00000085238] [ENSMUST00000182208] [ENSMUST00000182366]

AlphaFold

S4R2P9

Predicted Effect

probably benign
Transcript: ENSMUST00000064594

SMART Domains

Protein: ENSMUSP00000063258
Gene: ENSMUSG00000079055

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
Pfam:Na_Ca_ex	79	250	1.3e-36	PFAM
Pfam:Na_Ca_ex_C	253	379	4.6e-57	PFAM
Calx_beta	385	485	3.25e-42	SMART
Calx_beta	519	619	1.04e-40	SMART
low complexity region	712	723	N/A	INTRINSIC
Pfam:Na_Ca_ex	754	919	2e-27	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000085238

SMART Domains

Protein: ENSMUSP00000082334
Gene: ENSMUSG00000079055

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
Pfam:Na_Ca_ex	79	250	1.3e-36	PFAM
Pfam:Na_Ca_ex_C	253	379	4.6e-57	PFAM
Calx_beta	385	485	3.25e-42	SMART
Calx_beta	519	619	1.54e-43	SMART
low complexity region	705	716	N/A	INTRINSIC
Pfam:Na_Ca_ex	747	912	1.9e-27	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000182208
AA Change: K596N

PolyPhen 2 Score 0.704 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000138735
Gene: ENSMUSG00000079055
AA Change: K596N

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
Pfam:Na_Ca_ex	89	248	8.1e-38	PFAM
Calx_beta	385	485	3.25e-42	SMART
Calx_beta	519	619	1.04e-40	SMART
low complexity region	712	723	N/A	INTRINSIC
Pfam:Na_Ca_ex	764	917	9.1e-27	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000182366

SMART Domains

Protein: ENSMUSP00000138803
Gene: ENSMUSG00000079055

Domain	Start	End	E-Value	Type
PDB:2LT9\|A	1	52	2e-28	PDB
low complexity region	82	93	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium/calcium exchanger integral membrane protein family. Na+/Ca2+ exchange proteins are involved in maintaining Ca2+ homeostasis in a wide variety of cell types. The protein is regulated by intracellular calcium ions and is found in both the plasma membrane and intracellular organellar membranes, where exchange of Na+ for Ca2+ occurs in an electrogenic manner. Alternative splicing has been observed for this gene and multiple variants have been described. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810021J22Rik	T	A	11: 58,880,305	D204E	probably benign	Het
Adh1	T	G	3: 138,282,732	D155E	probably benign	Het
Akt1s1	T	C	7: 44,849,147	L2P	unknown	Het
Ash1l	T	A	3: 88,965,892		probably benign	Het
Bend7	C	T	2: 4,752,830	P228S	probably damaging	Het
Bpifc	T	C	10: 85,988,721	E218G	possibly damaging	Het
Cdk6	T	A	5: 3,429,001	F127Y	probably benign	Het
Cgnl1	A	T	9: 71,725,564	H168Q	possibly damaging	Het
Chd7	C	T	4: 8,847,093	T1612I	possibly damaging	Het
Col4a4	A	T	1: 82,492,463	C782S	unknown	Het
Copg2	T	A	6: 30,824,406	I364L	probably damaging	Het
Crygb	A	G	1: 65,081,925	L81P	probably benign	Het
Cyp4f18	A	T	8: 71,993,173	M326K	probably damaging	Het
Dhx34	A	G	7: 16,215,436	S356P	probably benign	Het
Dmbt1	C	T	7: 131,083,789	Q855*	probably null	Het
Dnph1	A	G	17: 46,499,012	N160S	probably benign	Het
Esrra	A	T	19: 6,912,771	C228*	probably null	Het
Evpl	T	C	11: 116,223,949	N972D	probably benign	Het
Fat3	T	C	9: 15,998,592	D2038G	probably damaging	Het
Fhit	T	A	14: 9,763,784	R102W	probably damaging	Het
Gal3st1	A	T	11: 3,998,609	D272V	probably damaging	Het
Gal3st1	T	A	11: 3,998,651	V286D	probably damaging	Het
Gemin4	A	T	11: 76,213,380	M185K	possibly damaging	Het
Hecw1	T	C	13: 14,316,236	I311V	probably benign	Het
Ift172	T	C	5: 31,285,286	Y179C	probably damaging	Het
Ighv7-3	C	T	12: 114,153,343	W66*	probably null	Het
Iqgap3	T	A	3: 88,108,835	I975N	probably damaging	Het
Khdrbs3	A	G	15: 69,049,413	E281G	possibly damaging	Het
Lamb2	A	T	9: 108,488,324	T1369S	probably benign	Het
Mettl8	A	T	2: 70,982,038	D84E	probably benign	Het
Mrgprb3	C	A	7: 48,643,311	C164F	probably damaging	Het
Mtg2	A	G	2: 180,083,387	Y131C	probably damaging	Het
Nacc1	C	T	8: 84,676,545	A234T	probably benign	Het
Nsmaf	C	T	4: 6,416,641	V551I	probably benign	Het
Olfr541	T	A	7: 140,705,029	C259*	probably null	Het
Olfr869	T	A	9: 20,137,441	Y108*	probably null	Het
Oxr1	C	T	15: 41,813,608	P187L	not run	Het
Pcdhb12	T	A	18: 37,436,015	D71E	probably benign	Het
Pigt	CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT	CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT	2: 164,499,669		probably null	Het
Pkm	A	G	9: 59,668,913	S127G	probably benign	Het
Plxna2	T	A	1: 194,796,919	L1296H	probably damaging	Het
Ppil6	C	G	10: 41,498,528	T135R	probably benign	Het
Ppp2r3a	T	C	9: 101,127,004	Y378C	probably damaging	Het
Rabep2	C	T	7: 126,444,205	R426C	probably damaging	Het
Rad21	A	T	15: 51,982,580	H31Q	possibly damaging	Het
Rad50	G	T	11: 53,654,949	Y1182*	probably null	Het
Serpinb9c	C	T	13: 33,151,900	A218T	possibly damaging	Het
Slc17a2	C	A	13: 23,819,112	H248Q	probably benign	Het
Slc45a4	C	A	15: 73,586,936	E255*	probably null	Het
Tbc1d32	A	C	10: 56,051,387		probably null	Het
Tbl2	T	A	5: 135,154,399	I112N	possibly damaging	Het
Tchp	A	C	5: 114,715,569	K238T	probably damaging	Het
Tfap2d	G	A	1: 19,118,983	G251D	probably damaging	Het
Thrb	T	A	14: 18,030,186	M324K	probably damaging	Het
Tmem259	A	T	10: 79,978,466	L328Q	probably damaging	Het
Tmtc2	T	C	10: 105,413,608	H88R	probably damaging	Het
Tnfrsf21	A	G	17: 43,037,818	H107R	possibly damaging	Het
Trib1	T	C	15: 59,654,622	V347A	probably benign	Het
Ung	T	A	5: 114,131,254	L9*	probably null	Het
Vmn1r195	G	T	13: 22,279,004	V215F	probably damaging	Het
Wdr63	T	C	3: 146,081,252	T343A	probably damaging	Het
Wdr90	A	G	17: 25,846,312	S1657P	probably benign	Het
Wdsub1	A	T	2: 59,878,143	Y129N	possibly damaging	Het
Zfp369	T	G	13: 65,285,018		probably null	Het
Zfp770	G	T	2: 114,195,661	C642*	probably null	Het
Zfp981	C	T	4: 146,537,643	R342C	probably benign	Het
Zhx3	A	C	2: 160,781,122	V375G	probably damaging	Het

Other mutations in Slc8a3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00164:Slc8a3	APN	12	81314569	missense	probably benign
IGL01315:Slc8a3	APN	12	81314395	missense	probably damaging	0.97
IGL01365:Slc8a3	APN	12	81315376	missense	probably damaging	0.99
IGL01610:Slc8a3	APN	12	81315802	missense	probably damaging	1.00
IGL02227:Slc8a3	APN	12	81315683	missense	probably damaging	1.00
IGL02299:Slc8a3	APN	12	81315224	missense	probably damaging	0.98
IGL02548:Slc8a3	APN	12	81204156	splice site	probably benign
IGL02646:Slc8a3	APN	12	81315094	missense	probably damaging	1.00
IGL03135:Slc8a3	APN	12	81202249	missense	probably damaging	1.00
R0050:Slc8a3	UTSW	12	81315265	missense	probably damaging	1.00
R0627:Slc8a3	UTSW	12	81314842	missense	probably damaging	1.00
R0648:Slc8a3	UTSW	12	81314446	missense	probably damaging	1.00
R1342:Slc8a3	UTSW	12	81316016	missense	probably damaging	0.99
R1437:Slc8a3	UTSW	12	81315986	missense	probably damaging	0.99
R1470:Slc8a3	UTSW	12	81199710	missense	probably benign
R1470:Slc8a3	UTSW	12	81199710	missense	probably benign
R1557:Slc8a3	UTSW	12	81315557	missense	probably damaging	1.00
R1563:Slc8a3	UTSW	12	81205007	missense	possibly damaging	0.47
R1918:Slc8a3	UTSW	12	81314844	missense	probably damaging	0.99
R1930:Slc8a3	UTSW	12	81314446	missense	probably damaging	1.00
R1931:Slc8a3	UTSW	12	81314446	missense	probably damaging	1.00
R2232:Slc8a3	UTSW	12	81315220	missense	probably damaging	0.99
R2680:Slc8a3	UTSW	12	81202339	missense	probably damaging	0.99
R2941:Slc8a3	UTSW	12	81315179	missense	probably damaging	1.00
R3157:Slc8a3	UTSW	12	81314992	missense	probably damaging	1.00
R3159:Slc8a3	UTSW	12	81314992	missense	probably damaging	1.00
R3751:Slc8a3	UTSW	12	81204138	missense	probably damaging	1.00
R3859:Slc8a3	UTSW	12	81314872	missense	probably damaging	0.99
R4240:Slc8a3	UTSW	12	81315176	missense	probably damaging	0.99
R4527:Slc8a3	UTSW	12	81315853	missense	probably damaging	1.00
R4547:Slc8a3	UTSW	12	81314851	missense	possibly damaging	0.76
R4951:Slc8a3	UTSW	12	81314699	missense	probably benign	0.31
R4951:Slc8a3	UTSW	12	81315986	missense	probably damaging	0.99
R5022:Slc8a3	UTSW	12	81199558	missense	probably damaging	0.96
R5049:Slc8a3	UTSW	12	81214132	missense	probably damaging	1.00
R5057:Slc8a3	UTSW	12	81199558	missense	probably damaging	0.96
R5104:Slc8a3	UTSW	12	81214134	missense	probably null	0.34
R5122:Slc8a3	UTSW	12	81314258	critical splice donor site	probably null
R5183:Slc8a3	UTSW	12	81314491	missense	possibly damaging	0.79
R5629:Slc8a3	UTSW	12	81199631	missense	probably damaging	1.00
R6062:Slc8a3	UTSW	12	81314350	missense	probably damaging	1.00
R6218:Slc8a3	UTSW	12	81199567	missense	probably benign
R6279:Slc8a3	UTSW	12	81314978	missense	probably damaging	0.99
R6300:Slc8a3	UTSW	12	81314978	missense	probably damaging	0.99
R6416:Slc8a3	UTSW	12	81315627	missense	probably damaging	1.00
R6790:Slc8a3	UTSW	12	81314432	missense	probably benign	0.00
R6999:Slc8a3	UTSW	12	81314755	missense	probably benign	0.06
R7195:Slc8a3	UTSW	12	81314273	missense	possibly damaging	0.95
R7268:Slc8a3	UTSW	12	81315053	missense	probably damaging	0.98
R7383:Slc8a3	UTSW	12	81315805	missense	probably damaging	1.00
R7392:Slc8a3	UTSW	12	81314803	missense	probably damaging	0.99
R7394:Slc8a3	UTSW	12	81214058	splice site	probably null
R7549:Slc8a3	UTSW	12	81314770	missense	probably benign	0.06
R7657:Slc8a3	UTSW	12	81314384	missense	probably damaging	1.00
R7699:Slc8a3	UTSW	12	81314473	missense	probably damaging	1.00
R7759:Slc8a3	UTSW	12	81314551	missense	probably benign
R7960:Slc8a3	UTSW	12	81216732	missense	probably benign	0.00
R7985:Slc8a3	UTSW	12	81314993	missense	probably damaging	1.00
R8059:Slc8a3	UTSW	12	81202258	missense	probably damaging	1.00
R8192:Slc8a3	UTSW	12	81199681	missense	probably damaging	1.00
R8397:Slc8a3	UTSW	12	81199768	missense	probably benign	0.45
R8413:Slc8a3	UTSW	12	81314678	missense	probably damaging	0.97
R8681:Slc8a3	UTSW	12	81315140	missense	probably benign
R9060:Slc8a3	UTSW	12	81214078	missense	probably benign	0.45
R9061:Slc8a3	UTSW	12	81216766	missense	probably damaging	0.99
R9267:Slc8a3	UTSW	12	81314434	missense	possibly damaging	0.77
R9416:Slc8a3	UTSW	12	81315064	missense	probably benign	0.06
R9519:Slc8a3	UTSW	12	81315552	missense	probably benign	0.30
R9531:Slc8a3	UTSW	12	81315223	missense	probably damaging	1.00
X0026:Slc8a3	UTSW	12	81315287	missense	probably benign	0.22
X0028:Slc8a3	UTSW	12	81314943	missense	probably damaging	1.00
Z1177:Slc8a3	UTSW	12	81314700	missense	possibly damaging	0.92
Z1177:Slc8a3	UTSW	12	81315876	missense	probably benign	0.13

Predicted Primers

PCR Primer
(F):5'- TACCATGTGACAGGTTGGC -3'
(R):5'- AAAGGACTCACTGAAGCTGG -3'

Sequencing Primer
(F):5'- ACAGGTTGGCAGGTGTTAGGAC -3'
(R):5'- ACTCACTGAAGCTGGAGGAG -3'

Posted On

2019-06-26