Incidental Mutation 'R7288:Zfp369'
ID566186
Institutional Source Beutler Lab
Gene Symbol Zfp369
Ensembl Gene ENSMUSG00000021514
Gene Namezinc finger protein 369
SynonymsB930030B22Rik, NRIF2, D230020H11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R7288 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location65278814-65304221 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to G at 65285018 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119114 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000126879] [ENSMUST00000130799] [ENSMUST00000155732]
Predicted Effect probably null
Transcript: ENSMUST00000126879
SMART Domains Protein: ENSMUSP00000119114
Gene: ENSMUSG00000021514

DomainStartEndE-ValueType
KRAB 35 95 7.13e-20 SMART
SCAN 178 289 2.57e-39 SMART
KRAB 300 367 1.63e-14 SMART
low complexity region 440 452 N/A INTRINSIC
ZnF_C2H2 701 723 5.42e-2 SMART
ZnF_C2H2 729 751 4.79e-3 SMART
ZnF_C2H2 757 779 1.47e-3 SMART
ZnF_C2H2 785 807 2.43e-4 SMART
ZnF_C2H2 813 835 6.88e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000130799
SMART Domains Protein: ENSMUSP00000116221
Gene: ENSMUSG00000021514

DomainStartEndE-ValueType
KRAB 35 95 7.13e-20 SMART
SCAN 178 289 2.57e-39 SMART
KRAB 300 354 3.54e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155732
SMART Domains Protein: ENSMUSP00000119796
Gene: ENSMUSG00000021514

DomainStartEndE-ValueType
KRAB 14 70 1.36e-16 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik T A 11: 58,880,305 D204E probably benign Het
Adh1 T G 3: 138,282,732 D155E probably benign Het
Akt1s1 T C 7: 44,849,147 L2P unknown Het
Ash1l T A 3: 88,965,892 probably benign Het
Bend7 C T 2: 4,752,830 P228S probably damaging Het
Bpifc T C 10: 85,988,721 E218G possibly damaging Het
Cdk6 T A 5: 3,429,001 F127Y probably benign Het
Cgnl1 A T 9: 71,725,564 H168Q possibly damaging Het
Chd7 C T 4: 8,847,093 T1612I possibly damaging Het
Col4a4 A T 1: 82,492,463 C782S unknown Het
Copg2 T A 6: 30,824,406 I364L probably damaging Het
Crygb A G 1: 65,081,925 L81P probably benign Het
Cyp4f18 A T 8: 71,993,173 M326K probably damaging Het
Dhx34 A G 7: 16,215,436 S356P probably benign Het
Dmbt1 C T 7: 131,083,789 Q855* probably null Het
Dnph1 A G 17: 46,499,012 N160S probably benign Het
Esrra A T 19: 6,912,771 C228* probably null Het
Evpl T C 11: 116,223,949 N972D probably benign Het
Fat3 T C 9: 15,998,592 D2038G probably damaging Het
Fhit T A 14: 9,763,784 R102W probably damaging Het
Gal3st1 A T 11: 3,998,609 D272V probably damaging Het
Gal3st1 T A 11: 3,998,651 V286D probably damaging Het
Gemin4 A T 11: 76,213,380 M185K possibly damaging Het
Hecw1 T C 13: 14,316,236 I311V probably benign Het
Ift172 T C 5: 31,285,286 Y179C probably damaging Het
Ighv7-3 C T 12: 114,153,343 W66* probably null Het
Iqgap3 T A 3: 88,108,835 I975N probably damaging Het
Khdrbs3 A G 15: 69,049,413 E281G possibly damaging Het
Lamb2 A T 9: 108,488,324 T1369S probably benign Het
Mettl8 A T 2: 70,982,038 D84E probably benign Het
Mrgprb3 C A 7: 48,643,311 C164F probably damaging Het
Mtg2 A G 2: 180,083,387 Y131C probably damaging Het
Nacc1 C T 8: 84,676,545 A234T probably benign Het
Nsmaf C T 4: 6,416,641 V551I probably benign Het
Olfr541 T A 7: 140,705,029 C259* probably null Het
Olfr869 T A 9: 20,137,441 Y108* probably null Het
Oxr1 C T 15: 41,813,608 P187L not run Het
Pcdhb12 T A 18: 37,436,015 D71E probably benign Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,499,669 probably null Het
Pkm A G 9: 59,668,913 S127G probably benign Het
Plxna2 T A 1: 194,796,919 L1296H probably damaging Het
Ppil6 C G 10: 41,498,528 T135R probably benign Het
Ppp2r3a T C 9: 101,127,004 Y378C probably damaging Het
Rabep2 C T 7: 126,444,205 R426C probably damaging Het
Rad21 A T 15: 51,982,580 H31Q possibly damaging Het
Rad50 G T 11: 53,654,949 Y1182* probably null Het
Serpinb9c C T 13: 33,151,900 A218T possibly damaging Het
Slc17a2 C A 13: 23,819,112 H248Q probably benign Het
Slc45a4 C A 15: 73,586,936 E255* probably null Het
Slc8a3 T A 12: 81,216,824 K596N possibly damaging Het
Tbc1d32 A C 10: 56,051,387 probably null Het
Tbl2 T A 5: 135,154,399 I112N possibly damaging Het
Tchp A C 5: 114,715,569 K238T probably damaging Het
Tfap2d G A 1: 19,118,983 G251D probably damaging Het
Thrb T A 14: 18,030,186 M324K probably damaging Het
Tmem259 A T 10: 79,978,466 L328Q probably damaging Het
Tmtc2 T C 10: 105,413,608 H88R probably damaging Het
Tnfrsf21 A G 17: 43,037,818 H107R possibly damaging Het
Trib1 T C 15: 59,654,622 V347A probably benign Het
Ung T A 5: 114,131,254 L9* probably null Het
Vmn1r195 G T 13: 22,279,004 V215F probably damaging Het
Wdr63 T C 3: 146,081,252 T343A probably damaging Het
Wdr90 A G 17: 25,846,312 S1657P probably benign Het
Wdsub1 A T 2: 59,878,143 Y129N possibly damaging Het
Zfp770 G T 2: 114,195,661 C642* probably null Het
Zfp981 C T 4: 146,537,643 R342C probably benign Het
Zhx3 A C 2: 160,781,122 V375G probably damaging Het
Other mutations in Zfp369
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00969:Zfp369 APN 13 65297260 missense probably benign 0.41
IGL01393:Zfp369 APN 13 65294474 missense possibly damaging 0.85
IGL02277:Zfp369 APN 13 65284932 missense probably damaging 1.00
IGL02986:Zfp369 APN 13 65280281 missense probably damaging 1.00
IGL02992:Zfp369 APN 13 65294451 missense possibly damaging 0.50
IGL03170:Zfp369 APN 13 65294410 missense probably damaging 0.99
IGL03351:Zfp369 APN 13 65296153 missense possibly damaging 0.95
R0136:Zfp369 UTSW 13 65297202 missense probably benign 0.08
R0600:Zfp369 UTSW 13 65296434 missense probably damaging 0.97
R0646:Zfp369 UTSW 13 65297548 missense probably damaging 1.00
R1190:Zfp369 UTSW 13 65292293 missense probably damaging 0.99
R1191:Zfp369 UTSW 13 65291962 nonsense probably null
R1528:Zfp369 UTSW 13 65292165 missense probably damaging 1.00
R1934:Zfp369 UTSW 13 65297151 missense probably damaging 1.00
R2168:Zfp369 UTSW 13 65296948 missense probably benign 0.01
R4386:Zfp369 UTSW 13 65296992 missense probably benign 0.00
R4928:Zfp369 UTSW 13 65296800 missense possibly damaging 0.91
R5127:Zfp369 UTSW 13 65279033 start gained probably benign
R5549:Zfp369 UTSW 13 65297380 missense probably damaging 1.00
R5740:Zfp369 UTSW 13 65296767 missense probably benign
R5743:Zfp369 UTSW 13 65295680 missense probably benign 0.02
R5840:Zfp369 UTSW 13 65297278 missense possibly damaging 0.46
R6351:Zfp369 UTSW 13 65296230 missense possibly damaging 0.83
R7248:Zfp369 UTSW 13 65296117 missense probably damaging 0.98
R7314:Zfp369 UTSW 13 65292104 missense probably damaging 0.97
R7470:Zfp369 UTSW 13 65292146 missense probably benign 0.12
R7508:Zfp369 UTSW 13 65279273 missense unknown
R7796:Zfp369 UTSW 13 65296215 missense probably benign
R7886:Zfp369 UTSW 13 65292054 missense possibly damaging 0.95
R7969:Zfp369 UTSW 13 65292054 missense possibly damaging 0.95
Z1177:Zfp369 UTSW 13 65292160 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATGCCCAAGACCTGAAGTC -3'
(R):5'- GCTTGTCATGTGAAAGGCCC -3'

Sequencing Primer
(F):5'- GACCTGAAGTCATCATGTCACAAC -3'
(R):5'- CTGGGCTTAATCACTAGCATCATG -3'
Posted On2019-06-26