Incidental Mutation 'R7288:Fhit'
ID566187
Institutional Source Beutler Lab
Gene Symbol Fhit
Ensembl Gene ENSMUSG00000060579
Gene Namefragile histidine triad gene
SynonymsFra14A2
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.857) question?
Stock #R7288 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location9550092-11162035 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 9763784 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 102 (R102W)
Ref Sequence ENSEMBL: ENSMUSP00000123874 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160340] [ENSMUST00000161302] [ENSMUST00000161895] [ENSMUST00000162278] [ENSMUST00000162817] [ENSMUST00000179394]
Predicted Effect probably damaging
Transcript: ENSMUST00000160340
AA Change: R165W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124017
Gene: ENSMUSG00000060579
AA Change: R165W

DomainStartEndE-ValueType
Pfam:DcpS_C 60 170 2e-9 PFAM
Pfam:HIT 72 168 6.8e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000161302
AA Change: R102W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123874
Gene: ENSMUSG00000060579
AA Change: R102W

DomainStartEndE-ValueType
Pfam:DcpS_C 7 110 8.2e-10 PFAM
Pfam:HIT 9 105 4.9e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000161895
AA Change: R102W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124957
Gene: ENSMUSG00000060579
AA Change: R102W

DomainStartEndE-ValueType
Pfam:DcpS_C 6 110 4.3e-10 PFAM
Pfam:HIT 9 105 2e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000162278
AA Change: R102W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124073
Gene: ENSMUSG00000060579
AA Change: R102W

DomainStartEndE-ValueType
Pfam:DcpS_C 7 110 8.2e-10 PFAM
Pfam:HIT 9 105 4.9e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162817
SMART Domains Protein: ENSMUSP00000124500
Gene: ENSMUSG00000060579

DomainStartEndE-ValueType
Pfam:DcpS_C 5 100 2.3e-7 PFAM
Pfam:HIT 9 100 1.9e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000179394
AA Change: R102W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136011
Gene: ENSMUSG00000060579
AA Change: R102W

DomainStartEndE-ValueType
Pfam:DcpS_C 7 110 8.2e-10 PFAM
Pfam:HIT 9 105 4.9e-28 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the HIT family of proteins that are characterized by the presence of a histidine triad sequence. The encoded protein is a diadenosine triphosphate hydrolase enzyme that cleaves the P(1)-P(3)-bis(5'-adenosyl) triphosphate (Ap3A) to yield AMP and ADP. This locus is very fragile and has been found to be altered in different types of cancers. Mice lacking the encoded protein display increased susceptibility to spontaneous and induced tumors. Ectopic expression of the encoded protein in such knockout mice inhibits tumor development. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
PHENOTYPE: Both homozygotes and heterozygotes for a targeted null mutation exhibit a similarly increased incidence of both spontaneous and nitrosomethylbenzalamine-induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik T A 11: 58,880,305 D204E probably benign Het
Adh1 T G 3: 138,282,732 D155E probably benign Het
Akt1s1 T C 7: 44,849,147 L2P unknown Het
Ash1l T A 3: 88,965,892 probably benign Het
Bend7 C T 2: 4,752,830 P228S probably damaging Het
Bpifc T C 10: 85,988,721 E218G possibly damaging Het
Cdk6 T A 5: 3,429,001 F127Y probably benign Het
Cgnl1 A T 9: 71,725,564 H168Q possibly damaging Het
Chd7 C T 4: 8,847,093 T1612I possibly damaging Het
Col4a4 A T 1: 82,492,463 C782S unknown Het
Copg2 T A 6: 30,824,406 I364L probably damaging Het
Crygb A G 1: 65,081,925 L81P probably benign Het
Cyp4f18 A T 8: 71,993,173 M326K probably damaging Het
Dhx34 A G 7: 16,215,436 S356P probably benign Het
Dmbt1 C T 7: 131,083,789 Q855* probably null Het
Dnph1 A G 17: 46,499,012 N160S probably benign Het
Esrra A T 19: 6,912,771 C228* probably null Het
Evpl T C 11: 116,223,949 N972D probably benign Het
Fat3 T C 9: 15,998,592 D2038G probably damaging Het
Gal3st1 A T 11: 3,998,609 D272V probably damaging Het
Gal3st1 T A 11: 3,998,651 V286D probably damaging Het
Gemin4 A T 11: 76,213,380 M185K possibly damaging Het
Hecw1 T C 13: 14,316,236 I311V probably benign Het
Ift172 T C 5: 31,285,286 Y179C probably damaging Het
Ighv7-3 C T 12: 114,153,343 W66* probably null Het
Iqgap3 T A 3: 88,108,835 I975N probably damaging Het
Khdrbs3 A G 15: 69,049,413 E281G possibly damaging Het
Lamb2 A T 9: 108,488,324 T1369S probably benign Het
Mettl8 A T 2: 70,982,038 D84E probably benign Het
Mrgprb3 C A 7: 48,643,311 C164F probably damaging Het
Mtg2 A G 2: 180,083,387 Y131C probably damaging Het
Nacc1 C T 8: 84,676,545 A234T probably benign Het
Nsmaf C T 4: 6,416,641 V551I probably benign Het
Olfr541 T A 7: 140,705,029 C259* probably null Het
Olfr869 T A 9: 20,137,441 Y108* probably null Het
Oxr1 C T 15: 41,813,608 P187L not run Het
Pcdhb12 T A 18: 37,436,015 D71E probably benign Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,499,669 probably null Het
Pkm A G 9: 59,668,913 S127G probably benign Het
Plxna2 T A 1: 194,796,919 L1296H probably damaging Het
Ppil6 C G 10: 41,498,528 T135R probably benign Het
Ppp2r3a T C 9: 101,127,004 Y378C probably damaging Het
Rabep2 C T 7: 126,444,205 R426C probably damaging Het
Rad21 A T 15: 51,982,580 H31Q possibly damaging Het
Rad50 G T 11: 53,654,949 Y1182* probably null Het
Serpinb9c C T 13: 33,151,900 A218T possibly damaging Het
Slc17a2 C A 13: 23,819,112 H248Q probably benign Het
Slc45a4 C A 15: 73,586,936 E255* probably null Het
Slc8a3 T A 12: 81,216,824 K596N possibly damaging Het
Tbc1d32 A C 10: 56,051,387 probably null Het
Tbl2 T A 5: 135,154,399 I112N possibly damaging Het
Tchp A C 5: 114,715,569 K238T probably damaging Het
Tfap2d G A 1: 19,118,983 G251D probably damaging Het
Thrb T A 14: 18,030,186 M324K probably damaging Het
Tmem259 A T 10: 79,978,466 L328Q probably damaging Het
Tmtc2 T C 10: 105,413,608 H88R probably damaging Het
Tnfrsf21 A G 17: 43,037,818 H107R possibly damaging Het
Trib1 T C 15: 59,654,622 V347A probably benign Het
Ung T A 5: 114,131,254 L9* probably null Het
Vmn1r195 G T 13: 22,279,004 V215F probably damaging Het
Wdr63 T C 3: 146,081,252 T343A probably damaging Het
Wdr90 A G 17: 25,846,312 S1657P probably benign Het
Wdsub1 A T 2: 59,878,143 Y129N possibly damaging Het
Zfp369 T G 13: 65,285,018 probably null Het
Zfp770 G T 2: 114,195,661 C642* probably null Het
Zfp981 C T 4: 146,537,643 R342C probably benign Het
Zhx3 A C 2: 160,781,122 V375G probably damaging Het
Other mutations in Fhit
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01411:Fhit APN 14 9573483 missense probably benign 0.19
IGL01412:Fhit APN 14 9870065 missense probably damaging 1.00
IGL02831:Fhit APN 14 9870080 missense probably benign 0.00
IGL03025:Fhit APN 14 10421534 missense probably damaging 1.00
overtax UTSW 14 10421534 missense probably damaging 1.00
R0464:Fhit UTSW 14 10991567 start gained probably benign
R0544:Fhit UTSW 14 9870172 missense probably damaging 1.00
R3545:Fhit UTSW 14 9870095 missense probably benign 0.03
R3547:Fhit UTSW 14 9870095 missense probably benign 0.03
R3548:Fhit UTSW 14 9870095 missense probably benign 0.03
R4033:Fhit UTSW 14 10751671 intron probably benign
R4685:Fhit UTSW 14 9870091 missense probably damaging 1.00
R4968:Fhit UTSW 14 10421522 missense probably damaging 1.00
R5624:Fhit UTSW 14 10421534 missense probably damaging 1.00
R6011:Fhit UTSW 14 9870068 missense probably benign 0.16
R6061:Fhit UTSW 14 9573435 missense probably benign 0.00
R6208:Fhit UTSW 14 9573435 missense probably benign 0.00
R6846:Fhit UTSW 14 9763762 missense possibly damaging 0.73
R7625:Fhit UTSW 14 9870177 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AGATTCTCCTGGTGGTCACTC -3'
(R):5'- ACTCCCATATGCCTCCAAGTTG -3'

Sequencing Primer
(F):5'- GGTGGTCACTCTTCCCTTGTTAG -3'
(R):5'- TTTCTTCTCAACAGGTTTCAGATG -3'
Posted On2019-06-26