Incidental Mutation 'R7288:Oxr1'
ID566189
Institutional Source Beutler Lab
Gene Symbol Oxr1
Ensembl Gene ENSMUSG00000022307
Gene Nameoxidation resistance 1
SynonymsC7B, 2210416C20Rik, C7
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7288 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location41447482-41861048 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 41813608 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 187 (P187L)
Ref Sequence ENSEMBL: ENSMUSP00000105926 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110297]
Predicted Effect not run
Transcript: ENSMUST00000110297
AA Change: P187L
SMART Domains Protein: ENSMUSP00000105926
Gene: ENSMUSG00000022307
AA Change: P187L

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
LysM 99 142 2.48e-9 SMART
low complexity region 201 208 N/A INTRINSIC
low complexity region 628 645 N/A INTRINSIC
TLDc 704 866 1.05e-80 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in progressive cerebellar neurodegeneration and ataxia, increased apoptosis in the cerebellar granule cell layer, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik T A 11: 58,880,305 D204E probably benign Het
Adh1 T G 3: 138,282,732 D155E probably benign Het
Akt1s1 T C 7: 44,849,147 L2P unknown Het
Ash1l T A 3: 88,965,892 probably benign Het
Bend7 C T 2: 4,752,830 P228S probably damaging Het
Bpifc T C 10: 85,988,721 E218G possibly damaging Het
Cdk6 T A 5: 3,429,001 F127Y probably benign Het
Cgnl1 A T 9: 71,725,564 H168Q possibly damaging Het
Chd7 C T 4: 8,847,093 T1612I possibly damaging Het
Col4a4 A T 1: 82,492,463 C782S unknown Het
Copg2 T A 6: 30,824,406 I364L probably damaging Het
Crygb A G 1: 65,081,925 L81P probably benign Het
Cyp4f18 A T 8: 71,993,173 M326K probably damaging Het
Dhx34 A G 7: 16,215,436 S356P probably benign Het
Dmbt1 C T 7: 131,083,789 Q855* probably null Het
Dnph1 A G 17: 46,499,012 N160S probably benign Het
Esrra A T 19: 6,912,771 C228* probably null Het
Evpl T C 11: 116,223,949 N972D probably benign Het
Fat3 T C 9: 15,998,592 D2038G probably damaging Het
Fhit T A 14: 9,763,784 R102W probably damaging Het
Gal3st1 A T 11: 3,998,609 D272V probably damaging Het
Gal3st1 T A 11: 3,998,651 V286D probably damaging Het
Gemin4 A T 11: 76,213,380 M185K possibly damaging Het
Hecw1 T C 13: 14,316,236 I311V probably benign Het
Ift172 T C 5: 31,285,286 Y179C probably damaging Het
Ighv7-3 C T 12: 114,153,343 W66* probably null Het
Iqgap3 T A 3: 88,108,835 I975N probably damaging Het
Khdrbs3 A G 15: 69,049,413 E281G possibly damaging Het
Lamb2 A T 9: 108,488,324 T1369S probably benign Het
Mettl8 A T 2: 70,982,038 D84E probably benign Het
Mrgprb3 C A 7: 48,643,311 C164F probably damaging Het
Mtg2 A G 2: 180,083,387 Y131C probably damaging Het
Nacc1 C T 8: 84,676,545 A234T probably benign Het
Nsmaf C T 4: 6,416,641 V551I probably benign Het
Olfr541 T A 7: 140,705,029 C259* probably null Het
Olfr869 T A 9: 20,137,441 Y108* probably null Het
Pcdhb12 T A 18: 37,436,015 D71E probably benign Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,499,669 probably null Het
Pkm A G 9: 59,668,913 S127G probably benign Het
Plxna2 T A 1: 194,796,919 L1296H probably damaging Het
Ppil6 C G 10: 41,498,528 T135R probably benign Het
Ppp2r3a T C 9: 101,127,004 Y378C probably damaging Het
Rabep2 C T 7: 126,444,205 R426C probably damaging Het
Rad21 A T 15: 51,982,580 H31Q possibly damaging Het
Rad50 G T 11: 53,654,949 Y1182* probably null Het
Serpinb9c C T 13: 33,151,900 A218T possibly damaging Het
Slc17a2 C A 13: 23,819,112 H248Q probably benign Het
Slc45a4 C A 15: 73,586,936 E255* probably null Het
Slc8a3 T A 12: 81,216,824 K596N possibly damaging Het
Tbc1d32 A C 10: 56,051,387 probably null Het
Tbl2 T A 5: 135,154,399 I112N possibly damaging Het
Tchp A C 5: 114,715,569 K238T probably damaging Het
Tfap2d G A 1: 19,118,983 G251D probably damaging Het
Thrb T A 14: 18,030,186 M324K probably damaging Het
Tmem259 A T 10: 79,978,466 L328Q probably damaging Het
Tmtc2 T C 10: 105,413,608 H88R probably damaging Het
Tnfrsf21 A G 17: 43,037,818 H107R possibly damaging Het
Trib1 T C 15: 59,654,622 V347A probably benign Het
Ung T A 5: 114,131,254 L9* probably null Het
Vmn1r195 G T 13: 22,279,004 V215F probably damaging Het
Wdr63 T C 3: 146,081,252 T343A probably damaging Het
Wdr90 A G 17: 25,846,312 S1657P probably benign Het
Wdsub1 A T 2: 59,878,143 Y129N possibly damaging Het
Zfp369 T G 13: 65,285,018 probably null Het
Zfp770 G T 2: 114,195,661 C642* probably null Het
Zfp981 C T 4: 146,537,643 R342C probably benign Het
Zhx3 A C 2: 160,781,122 V375G probably damaging Het
Other mutations in Oxr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00913:Oxr1 APN 15 41820143 missense possibly damaging 0.46
IGL02243:Oxr1 APN 15 41535701 utr 5 prime probably benign
IGL02711:Oxr1 APN 15 41653671 splice site probably benign
IGL02810:Oxr1 APN 15 41813583 missense probably benign 0.26
IGL02850:Oxr1 APN 15 41854933 missense probably damaging 1.00
IGL03028:Oxr1 APN 15 41817163 missense probably damaging 1.00
IGL03126:Oxr1 APN 15 41820249 missense possibly damaging 0.66
PIT4378001:Oxr1 UTSW 15 41801582 missense probably benign 0.01
R0004:Oxr1 UTSW 15 41820540 missense possibly damaging 0.64
R0276:Oxr1 UTSW 15 41820062 missense probably damaging 1.00
R0394:Oxr1 UTSW 15 41817197 missense probably damaging 1.00
R1513:Oxr1 UTSW 15 41797474 missense probably damaging 1.00
R1742:Oxr1 UTSW 15 41850559 missense probably damaging 1.00
R2145:Oxr1 UTSW 15 41819944 missense probably damaging 1.00
R2924:Oxr1 UTSW 15 41825957 missense probably benign 0.01
R3732:Oxr1 UTSW 15 41848701 missense probably damaging 1.00
R4537:Oxr1 UTSW 15 41820519 missense possibly damaging 0.67
R4722:Oxr1 UTSW 15 41813649 missense probably damaging 1.00
R4935:Oxr1 UTSW 15 41813584 missense probably benign 0.00
R5417:Oxr1 UTSW 15 41820371 missense probably benign 0.00
R6029:Oxr1 UTSW 15 41825901 missense probably damaging 1.00
R6187:Oxr1 UTSW 15 41825919 missense probably damaging 1.00
R6864:Oxr1 UTSW 15 41823387 missense probably damaging 1.00
R6950:Oxr1 UTSW 15 41820555 missense probably benign 0.00
R7225:Oxr1 UTSW 15 41813608 missense not run
R7305:Oxr1 UTSW 15 41813608 missense not run
R7575:Oxr1 UTSW 15 41823362 missense possibly damaging 0.80
R7729:Oxr1 UTSW 15 41823467 missense probably damaging 1.00
R7764:Oxr1 UTSW 15 41819867 missense probably benign
R7812:Oxr1 UTSW 15 41751742 start codon destroyed probably null
R7910:Oxr1 UTSW 15 41653634 missense possibly damaging 0.78
R7991:Oxr1 UTSW 15 41653634 missense possibly damaging 0.78
X0025:Oxr1 UTSW 15 41820452 missense probably damaging 1.00
Predicted Primers
Posted On2019-06-26