Incidental Mutation 'R7288:Slc45a4'
ID566193
Institutional Source Beutler Lab
Gene Symbol Slc45a4
Ensembl Gene ENSMUSG00000079020
Gene Namesolute carrier family 45, member 4
Synonyms9330175B01Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7288 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location73577424-73645762 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 73586936 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 255 (E255*)
Ref Sequence ENSEMBL: ENSMUSP00000121775 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054266] [ENSMUST00000076224] [ENSMUST00000132607] [ENSMUST00000151288]
Predicted Effect probably null
Transcript: ENSMUST00000054266
AA Change: E263*
SMART Domains Protein: ENSMUSP00000054651
Gene: ENSMUSG00000079020
AA Change: E263*

DomainStartEndE-ValueType
transmembrane domain 61 83 N/A INTRINSIC
transmembrane domain 88 110 N/A INTRINSIC
transmembrane domain 123 145 N/A INTRINSIC
low complexity region 157 169 N/A INTRINSIC
low complexity region 213 225 N/A INTRINSIC
transmembrane domain 240 262 N/A INTRINSIC
low complexity region 488 499 N/A INTRINSIC
low complexity region 501 518 N/A INTRINSIC
transmembrane domain 533 555 N/A INTRINSIC
transmembrane domain 585 604 N/A INTRINSIC
transmembrane domain 617 639 N/A INTRINSIC
transmembrane domain 643 665 N/A INTRINSIC
transmembrane domain 685 707 N/A INTRINSIC
transmembrane domain 717 739 N/A INTRINSIC
low complexity region 754 770 N/A INTRINSIC
low complexity region 775 786 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000076224
AA Change: E255*
SMART Domains Protein: ENSMUSP00000075577
Gene: ENSMUSG00000079020
AA Change: E255*

DomainStartEndE-ValueType
Pfam:MFS_2 52 266 1.6e-9 PFAM
low complexity region 480 491 N/A INTRINSIC
low complexity region 493 510 N/A INTRINSIC
transmembrane domain 525 547 N/A INTRINSIC
transmembrane domain 577 596 N/A INTRINSIC
transmembrane domain 609 631 N/A INTRINSIC
transmembrane domain 635 657 N/A INTRINSIC
transmembrane domain 677 699 N/A INTRINSIC
transmembrane domain 709 731 N/A INTRINSIC
low complexity region 746 762 N/A INTRINSIC
low complexity region 767 778 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000132607
AA Change: E61*
SMART Domains Protein: ENSMUSP00000115827
Gene: ENSMUSG00000079020
AA Change: E61*

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
transmembrane domain 39 61 N/A INTRINSIC
low complexity region 286 297 N/A INTRINSIC
low complexity region 299 316 N/A INTRINSIC
transmembrane domain 331 353 N/A INTRINSIC
transmembrane domain 383 402 N/A INTRINSIC
transmembrane domain 415 437 N/A INTRINSIC
transmembrane domain 441 463 N/A INTRINSIC
transmembrane domain 483 505 N/A INTRINSIC
transmembrane domain 515 537 N/A INTRINSIC
low complexity region 552 568 N/A INTRINSIC
low complexity region 573 584 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000144936
AA Change: E190*
SMART Domains Protein: ENSMUSP00000122825
Gene: ENSMUSG00000079020
AA Change: E190*

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
transmembrane domain 50 72 N/A INTRINSIC
low complexity region 85 97 N/A INTRINSIC
low complexity region 141 153 N/A INTRINSIC
transmembrane domain 168 190 N/A INTRINSIC
low complexity region 416 427 N/A INTRINSIC
low complexity region 429 446 N/A INTRINSIC
transmembrane domain 461 483 N/A INTRINSIC
transmembrane domain 513 532 N/A INTRINSIC
transmembrane domain 545 567 N/A INTRINSIC
transmembrane domain 571 593 N/A INTRINSIC
transmembrane domain 613 635 N/A INTRINSIC
transmembrane domain 645 667 N/A INTRINSIC
low complexity region 682 698 N/A INTRINSIC
low complexity region 703 714 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000151288
AA Change: E255*
SMART Domains Protein: ENSMUSP00000121775
Gene: ENSMUSG00000079020
AA Change: E255*

DomainStartEndE-ValueType
Pfam:MFS_2 52 266 1.6e-9 PFAM
low complexity region 480 491 N/A INTRINSIC
low complexity region 493 510 N/A INTRINSIC
transmembrane domain 525 547 N/A INTRINSIC
transmembrane domain 577 596 N/A INTRINSIC
transmembrane domain 609 631 N/A INTRINSIC
transmembrane domain 635 657 N/A INTRINSIC
transmembrane domain 677 699 N/A INTRINSIC
transmembrane domain 709 731 N/A INTRINSIC
low complexity region 746 762 N/A INTRINSIC
low complexity region 767 778 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik T A 11: 58,880,305 D204E probably benign Het
Adh1 T G 3: 138,282,732 D155E probably benign Het
Akt1s1 T C 7: 44,849,147 L2P unknown Het
Ash1l T A 3: 88,965,892 probably benign Het
Bend7 C T 2: 4,752,830 P228S probably damaging Het
Bpifc T C 10: 85,988,721 E218G possibly damaging Het
Cdk6 T A 5: 3,429,001 F127Y probably benign Het
Cgnl1 A T 9: 71,725,564 H168Q possibly damaging Het
Chd7 C T 4: 8,847,093 T1612I possibly damaging Het
Col4a4 A T 1: 82,492,463 C782S unknown Het
Copg2 T A 6: 30,824,406 I364L probably damaging Het
Crygb A G 1: 65,081,925 L81P probably benign Het
Cyp4f18 A T 8: 71,993,173 M326K probably damaging Het
Dhx34 A G 7: 16,215,436 S356P probably benign Het
Dmbt1 C T 7: 131,083,789 Q855* probably null Het
Dnph1 A G 17: 46,499,012 N160S probably benign Het
Esrra A T 19: 6,912,771 C228* probably null Het
Evpl T C 11: 116,223,949 N972D probably benign Het
Fat3 T C 9: 15,998,592 D2038G probably damaging Het
Fhit T A 14: 9,763,784 R102W probably damaging Het
Gal3st1 A T 11: 3,998,609 D272V probably damaging Het
Gal3st1 T A 11: 3,998,651 V286D probably damaging Het
Gemin4 A T 11: 76,213,380 M185K possibly damaging Het
Hecw1 T C 13: 14,316,236 I311V probably benign Het
Ift172 T C 5: 31,285,286 Y179C probably damaging Het
Ighv7-3 C T 12: 114,153,343 W66* probably null Het
Iqgap3 T A 3: 88,108,835 I975N probably damaging Het
Khdrbs3 A G 15: 69,049,413 E281G possibly damaging Het
Lamb2 A T 9: 108,488,324 T1369S probably benign Het
Mettl8 A T 2: 70,982,038 D84E probably benign Het
Mrgprb3 C A 7: 48,643,311 C164F probably damaging Het
Mtg2 A G 2: 180,083,387 Y131C probably damaging Het
Nacc1 C T 8: 84,676,545 A234T probably benign Het
Nsmaf C T 4: 6,416,641 V551I probably benign Het
Olfr541 T A 7: 140,705,029 C259* probably null Het
Olfr869 T A 9: 20,137,441 Y108* probably null Het
Oxr1 C T 15: 41,813,608 P187L not run Het
Pcdhb12 T A 18: 37,436,015 D71E probably benign Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,499,669 probably null Het
Pkm A G 9: 59,668,913 S127G probably benign Het
Plxna2 T A 1: 194,796,919 L1296H probably damaging Het
Ppil6 C G 10: 41,498,528 T135R probably benign Het
Ppp2r3a T C 9: 101,127,004 Y378C probably damaging Het
Rabep2 C T 7: 126,444,205 R426C probably damaging Het
Rad21 A T 15: 51,982,580 H31Q possibly damaging Het
Rad50 G T 11: 53,654,949 Y1182* probably null Het
Serpinb9c C T 13: 33,151,900 A218T possibly damaging Het
Slc17a2 C A 13: 23,819,112 H248Q probably benign Het
Slc8a3 T A 12: 81,216,824 K596N possibly damaging Het
Tbc1d32 A C 10: 56,051,387 probably null Het
Tbl2 T A 5: 135,154,399 I112N possibly damaging Het
Tchp A C 5: 114,715,569 K238T probably damaging Het
Tfap2d G A 1: 19,118,983 G251D probably damaging Het
Thrb T A 14: 18,030,186 M324K probably damaging Het
Tmem259 A T 10: 79,978,466 L328Q probably damaging Het
Tmtc2 T C 10: 105,413,608 H88R probably damaging Het
Tnfrsf21 A G 17: 43,037,818 H107R possibly damaging Het
Trib1 T C 15: 59,654,622 V347A probably benign Het
Ung T A 5: 114,131,254 L9* probably null Het
Vmn1r195 G T 13: 22,279,004 V215F probably damaging Het
Wdr63 T C 3: 146,081,252 T343A probably damaging Het
Wdr90 A G 17: 25,846,312 S1657P probably benign Het
Wdsub1 A T 2: 59,878,143 Y129N possibly damaging Het
Zfp369 T G 13: 65,285,018 probably null Het
Zfp770 G T 2: 114,195,661 C642* probably null Het
Zfp981 C T 4: 146,537,643 R342C probably benign Het
Zhx3 A C 2: 160,781,122 V375G probably damaging Het
Other mutations in Slc45a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Slc45a4 APN 15 73587655 missense probably damaging 1.00
IGL02506:Slc45a4 APN 15 73581838 missense probably benign 0.00
IGL02642:Slc45a4 APN 15 73586815 missense probably benign
IGL03195:Slc45a4 APN 15 73584423 missense possibly damaging 0.89
Undefined UTSW 15 73584450 missense probably damaging 1.00
R0048:Slc45a4 UTSW 15 73605436 splice site probably benign
R0189:Slc45a4 UTSW 15 73581914 missense probably benign 0.00
R0240:Slc45a4 UTSW 15 73581906 missense probably benign 0.02
R0240:Slc45a4 UTSW 15 73581906 missense probably benign 0.02
R0828:Slc45a4 UTSW 15 73586816 missense probably benign 0.01
R1172:Slc45a4 UTSW 15 73605429 splice site probably benign
R1331:Slc45a4 UTSW 15 73586747 missense probably benign 0.00
R1739:Slc45a4 UTSW 15 73586038 missense probably damaging 1.00
R2310:Slc45a4 UTSW 15 73589560 missense probably damaging 1.00
R4695:Slc45a4 UTSW 15 73582075 missense possibly damaging 0.94
R4904:Slc45a4 UTSW 15 73586842 missense probably benign 0.18
R4974:Slc45a4 UTSW 15 73584450 missense probably damaging 1.00
R6033:Slc45a4 UTSW 15 73581976 missense probably damaging 1.00
R6033:Slc45a4 UTSW 15 73581976 missense probably damaging 1.00
R6114:Slc45a4 UTSW 15 73605604 missense probably damaging 0.96
R7057:Slc45a4 UTSW 15 73587638 missense probably damaging 1.00
R7221:Slc45a4 UTSW 15 73586410 missense probably benign 0.06
R7331:Slc45a4 UTSW 15 73605640 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TAGTCCAAGGACAGCTCGTG -3'
(R):5'- TTGGCCACATAACCCTGTGTAAG -3'

Sequencing Primer
(F):5'- GCTCTGACTGTACCTCATCTGGG -3'
(R):5'- GGCTGAGGCTTACTGTCC -3'
Posted On2019-06-26