Incidental Mutation 'R7288:Pcdhb12'
ID566197
Institutional Source Beutler Lab
Gene Symbol Pcdhb12
Ensembl Gene ENSMUSG00000043458
Gene Nameprotocadherin beta 12
SynonymsPcdh3, PcdhbL, Pcdhb5F
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R7288 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location37435621-37438654 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 37436015 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 71 (D71E)
Ref Sequence ENSEMBL: ENSMUSP00000050357 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055495] [ENSMUST00000115661] [ENSMUST00000194544]
Predicted Effect probably benign
Transcript: ENSMUST00000055495
AA Change: D71E

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000050357
Gene: ENSMUSG00000043458
AA Change: D71E

DomainStartEndE-ValueType
CA 53 130 1.67e-1 SMART
CA 154 239 3.69e-23 SMART
CA 263 343 6.56e-29 SMART
CA 366 447 5.9e-22 SMART
CA 471 557 4.24e-23 SMART
CA 587 668 1.01e-11 SMART
Pfam:Cadherin_C_2 685 768 4.8e-26 PFAM
low complexity region 778 790 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik T A 11: 58,880,305 D204E probably benign Het
Adh1 T G 3: 138,282,732 D155E probably benign Het
Akt1s1 T C 7: 44,849,147 L2P unknown Het
Ash1l T A 3: 88,965,892 probably benign Het
Bend7 C T 2: 4,752,830 P228S probably damaging Het
Bpifc T C 10: 85,988,721 E218G possibly damaging Het
Cdk6 T A 5: 3,429,001 F127Y probably benign Het
Cgnl1 A T 9: 71,725,564 H168Q possibly damaging Het
Chd7 C T 4: 8,847,093 T1612I possibly damaging Het
Col4a4 A T 1: 82,492,463 C782S unknown Het
Copg2 T A 6: 30,824,406 I364L probably damaging Het
Crygb A G 1: 65,081,925 L81P probably benign Het
Cyp4f18 A T 8: 71,993,173 M326K probably damaging Het
Dhx34 A G 7: 16,215,436 S356P probably benign Het
Dmbt1 C T 7: 131,083,789 Q855* probably null Het
Dnph1 A G 17: 46,499,012 N160S probably benign Het
Esrra A T 19: 6,912,771 C228* probably null Het
Evpl T C 11: 116,223,949 N972D probably benign Het
Fat3 T C 9: 15,998,592 D2038G probably damaging Het
Fhit T A 14: 9,763,784 R102W probably damaging Het
Gal3st1 A T 11: 3,998,609 D272V probably damaging Het
Gal3st1 T A 11: 3,998,651 V286D probably damaging Het
Gemin4 A T 11: 76,213,380 M185K possibly damaging Het
Hecw1 T C 13: 14,316,236 I311V probably benign Het
Ift172 T C 5: 31,285,286 Y179C probably damaging Het
Ighv7-3 C T 12: 114,153,343 W66* probably null Het
Iqgap3 T A 3: 88,108,835 I975N probably damaging Het
Khdrbs3 A G 15: 69,049,413 E281G possibly damaging Het
Lamb2 A T 9: 108,488,324 T1369S probably benign Het
Mettl8 A T 2: 70,982,038 D84E probably benign Het
Mrgprb3 C A 7: 48,643,311 C164F probably damaging Het
Mtg2 A G 2: 180,083,387 Y131C probably damaging Het
Nacc1 C T 8: 84,676,545 A234T probably benign Het
Nsmaf C T 4: 6,416,641 V551I probably benign Het
Olfr541 T A 7: 140,705,029 C259* probably null Het
Olfr869 T A 9: 20,137,441 Y108* probably null Het
Oxr1 C T 15: 41,813,608 P187L not run Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,499,669 probably null Het
Pkm A G 9: 59,668,913 S127G probably benign Het
Plxna2 T A 1: 194,796,919 L1296H probably damaging Het
Ppil6 C G 10: 41,498,528 T135R probably benign Het
Ppp2r3a T C 9: 101,127,004 Y378C probably damaging Het
Rabep2 C T 7: 126,444,205 R426C probably damaging Het
Rad21 A T 15: 51,982,580 H31Q possibly damaging Het
Rad50 G T 11: 53,654,949 Y1182* probably null Het
Serpinb9c C T 13: 33,151,900 A218T possibly damaging Het
Slc17a2 C A 13: 23,819,112 H248Q probably benign Het
Slc45a4 C A 15: 73,586,936 E255* probably null Het
Slc8a3 T A 12: 81,216,824 K596N possibly damaging Het
Tbc1d32 A C 10: 56,051,387 probably null Het
Tbl2 T A 5: 135,154,399 I112N possibly damaging Het
Tchp A C 5: 114,715,569 K238T probably damaging Het
Tfap2d G A 1: 19,118,983 G251D probably damaging Het
Thrb T A 14: 18,030,186 M324K probably damaging Het
Tmem259 A T 10: 79,978,466 L328Q probably damaging Het
Tmtc2 T C 10: 105,413,608 H88R probably damaging Het
Tnfrsf21 A G 17: 43,037,818 H107R possibly damaging Het
Trib1 T C 15: 59,654,622 V347A probably benign Het
Ung T A 5: 114,131,254 L9* probably null Het
Vmn1r195 G T 13: 22,279,004 V215F probably damaging Het
Wdr63 T C 3: 146,081,252 T343A probably damaging Het
Wdr90 A G 17: 25,846,312 S1657P probably benign Het
Wdsub1 A T 2: 59,878,143 Y129N possibly damaging Het
Zfp369 T G 13: 65,285,018 probably null Het
Zfp770 G T 2: 114,195,661 C642* probably null Het
Zfp981 C T 4: 146,537,643 R342C probably benign Het
Zhx3 A C 2: 160,781,122 V375G probably damaging Het
Other mutations in Pcdhb12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Pcdhb12 APN 18 37436982 missense probably benign 0.44
IGL01309:Pcdhb12 APN 18 37436154 missense probably damaging 1.00
IGL01834:Pcdhb12 APN 18 37437639 missense probably damaging 1.00
IGL01893:Pcdhb12 APN 18 37437210 missense probably benign 0.01
IGL02617:Pcdhb12 APN 18 37437046 missense probably benign 0.43
R0238:Pcdhb12 UTSW 18 37436727 missense probably benign 0.00
R0238:Pcdhb12 UTSW 18 37436727 missense probably benign 0.00
R0309:Pcdhb12 UTSW 18 37436121 missense probably benign
R0392:Pcdhb12 UTSW 18 37436958 missense possibly damaging 0.60
R0494:Pcdhb12 UTSW 18 37438095 missense probably benign
R0531:Pcdhb12 UTSW 18 37437318 missense probably damaging 1.00
R0571:Pcdhb12 UTSW 18 37437208 missense probably damaging 1.00
R0737:Pcdhb12 UTSW 18 37437709 missense probably damaging 1.00
R0882:Pcdhb12 UTSW 18 37437322 missense probably damaging 1.00
R1253:Pcdhb12 UTSW 18 37435821 missense possibly damaging 0.65
R1300:Pcdhb12 UTSW 18 37437397 missense possibly damaging 0.45
R1334:Pcdhb12 UTSW 18 37436671 missense probably damaging 0.98
R1424:Pcdhb12 UTSW 18 37438079 missense probably benign
R1513:Pcdhb12 UTSW 18 37437058 missense probably damaging 1.00
R1654:Pcdhb12 UTSW 18 37436701 missense probably damaging 1.00
R1717:Pcdhb12 UTSW 18 37436788 missense probably damaging 1.00
R1753:Pcdhb12 UTSW 18 37436671 missense probably damaging 0.98
R1774:Pcdhb12 UTSW 18 37436442 missense possibly damaging 0.52
R1893:Pcdhb12 UTSW 18 37437083 missense probably benign 0.24
R1901:Pcdhb12 UTSW 18 37437630 missense possibly damaging 0.67
R2114:Pcdhb12 UTSW 18 37436212 missense probably damaging 1.00
R2264:Pcdhb12 UTSW 18 37436805 missense probably damaging 0.99
R2915:Pcdhb12 UTSW 18 37437640 missense probably damaging 1.00
R3689:Pcdhb12 UTSW 18 37436074 missense probably benign 0.01
R3918:Pcdhb12 UTSW 18 37437048 missense probably benign
R4621:Pcdhb12 UTSW 18 37437160 missense probably benign
R4679:Pcdhb12 UTSW 18 37436949 missense probably damaging 1.00
R4709:Pcdhb12 UTSW 18 37437495 missense probably benign 0.08
R4904:Pcdhb12 UTSW 18 37437856 missense possibly damaging 0.80
R4953:Pcdhb12 UTSW 18 37436156 missense probably damaging 1.00
R5091:Pcdhb12 UTSW 18 37435854 nonsense probably null
R5130:Pcdhb12 UTSW 18 37435824 missense probably benign
R5204:Pcdhb12 UTSW 18 37436089 missense probably damaging 0.99
R5361:Pcdhb12 UTSW 18 37437046 missense probably damaging 1.00
R5417:Pcdhb12 UTSW 18 37436034 missense probably benign 0.00
R5979:Pcdhb12 UTSW 18 37437991 missense possibly damaging 0.94
R6117:Pcdhb12 UTSW 18 37435642 intron probably benign
R6258:Pcdhb12 UTSW 18 37436839 missense probably benign 0.00
R6260:Pcdhb12 UTSW 18 37436839 missense probably benign 0.00
R6270:Pcdhb12 UTSW 18 37436785 missense possibly damaging 0.68
R6623:Pcdhb12 UTSW 18 37437658 missense possibly damaging 0.54
R7733:Pcdhb12 UTSW 18 37437036 missense probably damaging 1.00
R7762:Pcdhb12 UTSW 18 37435924 missense probably damaging 0.98
R8131:Pcdhb12 UTSW 18 37437282 missense possibly damaging 0.91
R8331:Pcdhb12 UTSW 18 37437289 missense probably damaging 1.00
R8483:Pcdhb12 UTSW 18 37437537 missense possibly damaging 0.86
R8553:Pcdhb12 UTSW 18 37437634 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGAATCTGCACAACGGAGAC -3'
(R):5'- TTTCCGTGTCAGAGAACTCC -3'

Sequencing Primer
(F):5'- CAACGGAGACAGCGCTAGC -3'
(R):5'- CTCCGGAGAGTGGTCGTTTATATCAG -3'
Posted On2019-06-26