Incidental Mutation 'R0635:Specc1'
ID56620
Institutional Source Beutler Lab
Gene Symbol Specc1
Ensembl Gene ENSMUSG00000042331
Gene Namesperm antigen with calponin homology and coiled-coil domains 1
SynonymsCytsb
MMRRC Submission 038824-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R0635 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location61956763-62223013 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 62118903 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 495 (R495Q)
Ref Sequence ENSEMBL: ENSMUSP00000144311 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049836] [ENSMUST00000092415] [ENSMUST00000108709] [ENSMUST00000201015] [ENSMUST00000201364] [ENSMUST00000201624] [ENSMUST00000201671] [ENSMUST00000201723] [ENSMUST00000202178] [ENSMUST00000202179] [ENSMUST00000202905] [ENSMUST00000202389] [ENSMUST00000202744]
Predicted Effect probably damaging
Transcript: ENSMUST00000049836
AA Change: R495Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000063102
Gene: ENSMUSG00000042331
AA Change: R495Q

DomainStartEndE-ValueType
low complexity region 26 40 N/A INTRINSIC
low complexity region 123 143 N/A INTRINSIC
coiled coil region 159 196 N/A INTRINSIC
coiled coil region 224 259 N/A INTRINSIC
low complexity region 311 316 N/A INTRINSIC
coiled coil region 362 454 N/A INTRINSIC
coiled coil region 479 520 N/A INTRINSIC
coiled coil region 575 773 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000092415
AA Change: R415Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090071
Gene: ENSMUSG00000042331
AA Change: R415Q

DomainStartEndE-ValueType
low complexity region 43 63 N/A INTRINSIC
coiled coil region 79 116 N/A INTRINSIC
coiled coil region 144 179 N/A INTRINSIC
low complexity region 231 236 N/A INTRINSIC
coiled coil region 282 374 N/A INTRINSIC
coiled coil region 399 440 N/A INTRINSIC
coiled coil region 495 693 N/A INTRINSIC
low complexity region 805 816 N/A INTRINSIC
low complexity region 832 844 N/A INTRINSIC
CH 883 981 2.69e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108709
AA Change: R495Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104349
Gene: ENSMUSG00000042331
AA Change: R495Q

DomainStartEndE-ValueType
low complexity region 26 40 N/A INTRINSIC
low complexity region 123 143 N/A INTRINSIC
coiled coil region 159 196 N/A INTRINSIC
coiled coil region 224 259 N/A INTRINSIC
low complexity region 311 316 N/A INTRINSIC
coiled coil region 362 454 N/A INTRINSIC
coiled coil region 479 520 N/A INTRINSIC
coiled coil region 575 773 N/A INTRINSIC
low complexity region 885 896 N/A INTRINSIC
low complexity region 912 924 N/A INTRINSIC
CH 963 1061 2.69e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201015
SMART Domains Protein: ENSMUSP00000144174
Gene: ENSMUSG00000042331

DomainStartEndE-ValueType
coiled coil region 23 113 N/A INTRINSIC
low complexity region 225 236 N/A INTRINSIC
low complexity region 252 264 N/A INTRINSIC
CH 303 401 1.4e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000201364
AA Change: R495Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143853
Gene: ENSMUSG00000042331
AA Change: R495Q

DomainStartEndE-ValueType
low complexity region 26 40 N/A INTRINSIC
low complexity region 123 143 N/A INTRINSIC
coiled coil region 159 196 N/A INTRINSIC
coiled coil region 224 259 N/A INTRINSIC
low complexity region 311 316 N/A INTRINSIC
coiled coil region 362 454 N/A INTRINSIC
coiled coil region 479 520 N/A INTRINSIC
coiled coil region 575 773 N/A INTRINSIC
low complexity region 876 887 N/A INTRINSIC
low complexity region 903 915 N/A INTRINSIC
CH 954 1052 2.69e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000201624
AA Change: R495Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144659
Gene: ENSMUSG00000042331
AA Change: R495Q

DomainStartEndE-ValueType
low complexity region 26 40 N/A INTRINSIC
low complexity region 123 143 N/A INTRINSIC
coiled coil region 159 196 N/A INTRINSIC
coiled coil region 224 259 N/A INTRINSIC
low complexity region 311 316 N/A INTRINSIC
coiled coil region 362 454 N/A INTRINSIC
coiled coil region 479 520 N/A INTRINSIC
coiled coil region 575 773 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000201671
AA Change: R495Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144030
Gene: ENSMUSG00000042331
AA Change: R495Q

DomainStartEndE-ValueType
low complexity region 26 40 N/A INTRINSIC
low complexity region 123 143 N/A INTRINSIC
coiled coil region 159 196 N/A INTRINSIC
coiled coil region 224 259 N/A INTRINSIC
low complexity region 311 316 N/A INTRINSIC
coiled coil region 362 454 N/A INTRINSIC
coiled coil region 479 520 N/A INTRINSIC
coiled coil region 575 773 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000201723
AA Change: R415Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144542
Gene: ENSMUSG00000042331
AA Change: R415Q

DomainStartEndE-ValueType
low complexity region 43 63 N/A INTRINSIC
coiled coil region 79 116 N/A INTRINSIC
coiled coil region 144 179 N/A INTRINSIC
low complexity region 231 236 N/A INTRINSIC
coiled coil region 282 374 N/A INTRINSIC
coiled coil region 399 440 N/A INTRINSIC
coiled coil region 495 693 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201866
Predicted Effect probably damaging
Transcript: ENSMUST00000202178
AA Change: R495Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144161
Gene: ENSMUSG00000042331
AA Change: R495Q

DomainStartEndE-ValueType
low complexity region 26 40 N/A INTRINSIC
low complexity region 123 143 N/A INTRINSIC
coiled coil region 159 196 N/A INTRINSIC
coiled coil region 224 259 N/A INTRINSIC
low complexity region 311 316 N/A INTRINSIC
coiled coil region 362 454 N/A INTRINSIC
coiled coil region 479 520 N/A INTRINSIC
coiled coil region 575 773 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000202179
AA Change: R415Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144300
Gene: ENSMUSG00000042331
AA Change: R415Q

DomainStartEndE-ValueType
low complexity region 43 63 N/A INTRINSIC
coiled coil region 79 116 N/A INTRINSIC
coiled coil region 144 179 N/A INTRINSIC
low complexity region 231 236 N/A INTRINSIC
coiled coil region 282 374 N/A INTRINSIC
coiled coil region 399 440 N/A INTRINSIC
coiled coil region 495 693 N/A INTRINSIC
low complexity region 796 807 N/A INTRINSIC
low complexity region 823 835 N/A INTRINSIC
CH 874 972 2.69e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000202905
AA Change: R495Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144311
Gene: ENSMUSG00000042331
AA Change: R495Q

DomainStartEndE-ValueType
low complexity region 26 40 N/A INTRINSIC
low complexity region 123 143 N/A INTRINSIC
coiled coil region 159 196 N/A INTRINSIC
coiled coil region 224 259 N/A INTRINSIC
low complexity region 311 316 N/A INTRINSIC
coiled coil region 362 454 N/A INTRINSIC
coiled coil region 479 520 N/A INTRINSIC
coiled coil region 575 773 N/A INTRINSIC
low complexity region 885 896 N/A INTRINSIC
low complexity region 912 924 N/A INTRINSIC
CH 963 1061 2.69e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000202389
AA Change: R495Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144055
Gene: ENSMUSG00000042331
AA Change: R495Q

DomainStartEndE-ValueType
low complexity region 26 40 N/A INTRINSIC
low complexity region 123 143 N/A INTRINSIC
coiled coil region 159 196 N/A INTRINSIC
coiled coil region 224 259 N/A INTRINSIC
low complexity region 311 316 N/A INTRINSIC
coiled coil region 362 454 N/A INTRINSIC
coiled coil region 479 520 N/A INTRINSIC
coiled coil region 575 773 N/A INTRINSIC
low complexity region 885 896 N/A INTRINSIC
low complexity region 912 924 N/A INTRINSIC
CH 963 1061 2.69e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202744
SMART Domains Protein: ENSMUSP00000144483
Gene: ENSMUSG00000042331

DomainStartEndE-ValueType
coiled coil region 23 113 N/A INTRINSIC
Meta Mutation Damage Score 0.1510 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.9%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the cytospin-A family. It is localized in the nucleus, and highly expressed in testis and some cancer cell lines. A chromosomal translocation involving this gene and platelet-derived growth factor receptor, beta gene (PDGFRB) may be a cause of juvenile myelomonocytic leukemia. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik A G 14: 49,773,143 L369S probably benign Het
4932429P05Rik T C X: 89,752,522 probably benign Het
5730455P16Rik A T 11: 80,374,065 probably benign Het
Adamts15 A G 9: 30,904,770 L631P probably damaging Het
Adamts17 T C 7: 66,908,605 F266L probably damaging Het
Adgrb1 C A 15: 74,540,892 Q488K possibly damaging Het
Cep290 A G 10: 100,492,676 D109G probably damaging Het
Chil5 A T 3: 106,017,203 Y229N possibly damaging Het
Cntnap1 A G 11: 101,183,459 T742A probably benign Het
Col6a3 A T 1: 90,808,086 probably null Het
Col6a5 G A 9: 105,928,606 P1034S unknown Het
Daxx T A 17: 33,912,644 D442E probably benign Het
Dmxl1 T C 18: 49,851,423 probably benign Het
Dnah11 A G 12: 118,007,996 F2942S probably damaging Het
Fam71a T C 1: 191,163,727 T240A probably benign Het
Glg1 A G 8: 111,163,764 probably benign Het
Gm10272 G A 10: 77,706,701 probably benign Het
Gm17333 AAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAA AAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAA 16: 77,852,878 noncoding transcript Het
Haao A G 17: 83,838,574 F83S probably damaging Het
Hdgfl2 T A 17: 56,096,057 L177Q probably damaging Het
Hrh1 T C 6: 114,480,145 V129A probably damaging Het
Ift43 T A 12: 86,085,081 probably benign Het
Il21r T C 7: 125,632,506 Y369H probably damaging Het
Il2ra C T 2: 11,680,366 T171M probably benign Het
Lao1 C T 4: 118,968,296 R438C probably benign Het
Lrrcc1 G A 3: 14,559,228 S350N probably benign Het
Mageb5 T A X: 91,779,993 Y260F probably benign Het
March5 A T 19: 37,220,408 I159F possibly damaging Het
Mgat4a G A 1: 37,452,294 A282V probably benign Het
Mipep G A 14: 60,829,390 V420I probably damaging Het
Morc2b A T 17: 33,137,687 F370L possibly damaging Het
Mt1 A T 8: 94,179,821 probably null Het
Ncapd2 A G 6: 125,173,036 V943A probably benign Het
Nkd2 T C 13: 73,826,894 D58G probably benign Het
Nol8 C G 13: 49,676,758 S1106C probably benign Het
Nrm C A 17: 35,864,264 Y61* probably null Het
Nusap1 A G 2: 119,627,667 T95A probably damaging Het
Ocln T A 13: 100,506,236 Q197L probably damaging Het
Olfr495 T A 7: 108,395,764 F215I probably benign Het
Oxtr A G 6: 112,489,200 Y200H probably damaging Het
Paip2b T C 6: 83,809,909 E115G possibly damaging Het
Pcm1 T A 8: 41,267,179 probably benign Het
Pcnt T C 10: 76,404,585 D1205G probably damaging Het
Phka1 G A X: 102,621,400 R186C probably damaging Het
Pik3cb A G 9: 99,064,218 probably benign Het
Pik3r1 C T 13: 101,757,418 R81K probably benign Het
Ppa1 A G 10: 61,665,440 D162G probably benign Het
Ppa1 A G 10: 61,666,970 R191G probably damaging Het
Prss22 T A 17: 23,996,688 T87S probably benign Het
Rgr T A 14: 37,038,947 R218* probably null Het
Rreb1 A T 13: 37,941,564 Q1282L possibly damaging Het
Scel T A 14: 103,583,139 probably null Het
Sema6b A G 17: 56,129,971 probably null Het
Slc4a1 T C 11: 102,352,672 E711G possibly damaging Het
Snx19 C A 9: 30,428,810 L415M probably damaging Het
Snx19 T G 9: 30,428,811 L415R probably damaging Het
Tead1 T C 7: 112,891,706 probably benign Het
Timm10b A C 7: 105,640,688 probably benign Het
Ubxn7 T A 16: 32,367,417 probably benign Het
Vmn2r116 T A 17: 23,386,887 Y258N possibly damaging Het
Vmn2r77 T A 7: 86,811,175 F570I probably benign Het
Vmn2r98 T C 17: 19,080,497 V587A probably benign Het
Zfp398 T C 6: 47,863,140 I101T probably damaging Het
Zfp808 T A 13: 62,172,419 H487Q probably damaging Het
Other mutations in Specc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Specc1 APN 11 62118009 missense probably benign 0.02
IGL01953:Specc1 APN 11 62118296 missense probably benign 0.40
IGL02244:Specc1 APN 11 62128368 missense probably benign 0.41
IGL02257:Specc1 APN 11 62118417 missense probably damaging 1.00
IGL02512:Specc1 APN 11 62118389 missense probably damaging 1.00
IGL03147:Specc1 UTSW 11 62118282 missense probably benign
R0039:Specc1 UTSW 11 62029369 missense probably damaging 0.97
R0114:Specc1 UTSW 11 62146313 missense possibly damaging 0.92
R1514:Specc1 UTSW 11 62156532 missense probably damaging 1.00
R1604:Specc1 UTSW 11 62043057 missense probably damaging 1.00
R1717:Specc1 UTSW 11 62128392 missense possibly damaging 0.88
R1719:Specc1 UTSW 11 62128392 missense possibly damaging 0.88
R1739:Specc1 UTSW 11 62118818 nonsense probably null
R1757:Specc1 UTSW 11 62119284 critical splice donor site probably null
R1990:Specc1 UTSW 11 62029294 missense possibly damaging 0.87
R1991:Specc1 UTSW 11 62029294 missense possibly damaging 0.87
R2063:Specc1 UTSW 11 62118296 missense probably benign 0.01
R2071:Specc1 UTSW 11 62117875 missense probably damaging 0.98
R2245:Specc1 UTSW 11 62131887 missense probably damaging 1.00
R3415:Specc1 UTSW 11 62118419 missense probably benign 0.29
R3831:Specc1 UTSW 11 62117967 missense probably damaging 1.00
R3890:Specc1 UTSW 11 62151913 missense probably benign 0.00
R3891:Specc1 UTSW 11 62151913 missense probably benign 0.00
R4367:Specc1 UTSW 11 62118530 missense probably damaging 1.00
R4489:Specc1 UTSW 11 62151827 splice site probably null
R4580:Specc1 UTSW 11 62219331 missense probably damaging 1.00
R4852:Specc1 UTSW 11 62211684 missense probably damaging 1.00
R4930:Specc1 UTSW 11 62118958 missense possibly damaging 0.93
R5016:Specc1 UTSW 11 62118957 missense possibly damaging 0.92
R5416:Specc1 UTSW 11 62118909 missense probably benign 0.00
R5650:Specc1 UTSW 11 62117967 missense probably damaging 1.00
R6158:Specc1 UTSW 11 62118124 missense probably damaging 0.99
R6329:Specc1 UTSW 11 62156553 missense probably damaging 1.00
R6374:Specc1 UTSW 11 62156592 missense possibly damaging 0.93
R6395:Specc1 UTSW 11 62132338 missense probably damaging 1.00
R6653:Specc1 UTSW 11 62146418 missense probably damaging 0.99
R6893:Specc1 UTSW 11 62132453 missense probably benign
R6898:Specc1 UTSW 11 62118336 missense probably benign
R7054:Specc1 UTSW 11 62117778 missense probably damaging 0.96
R7294:Specc1 UTSW 11 62118337 missense probably benign 0.01
R7376:Specc1 UTSW 11 62118252 missense probably benign 0.06
R7560:Specc1 UTSW 11 62128409 critical splice donor site probably null
R7605:Specc1 UTSW 11 62211680 missense possibly damaging 0.91
R7621:Specc1 UTSW 11 62128384 missense possibly damaging 0.96
R7804:Specc1 UTSW 11 62205397 missense probably damaging 0.99
R7900:Specc1 UTSW 11 62219361 missense probably damaging 1.00
R8310:Specc1 UTSW 11 62132345 missense probably damaging 1.00
R8319:Specc1 UTSW 11 62118675 missense possibly damaging 0.77
Z1177:Specc1 UTSW 11 62118767 missense possibly damaging 0.86
Z1177:Specc1 UTSW 11 62205423 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- GCAGGAATTATCAGACCAGCAGCAG -3'
(R):5'- TTCAAGCCTTCCAAGGTAACTCGAC -3'

Sequencing Primer
(F):5'- GAGAAGACCATTCTGGAGACCTC -3'
(R):5'- GGTAACTCGACATTCCTCCAGAG -3'
Posted On2013-07-11