Incidental Mutation 'R7289:Szt2'
ID566218
Institutional Source Beutler Lab
Gene Symbol Szt2
Ensembl Gene ENSMUSG00000033253
Gene Nameseizure threshold 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.689) question?
Stock #R7289 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location118362743-118409273 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 118375878 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 2297 (T2297I)
Ref Sequence ENSEMBL: ENSMUSP00000074862 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075406]
Predicted Effect unknown
Transcript: ENSMUST00000075406
AA Change: T2297I
SMART Domains Protein: ENSMUSP00000074862
Gene: ENSMUSG00000033253
AA Change: T2297I

DomainStartEndE-ValueType
low complexity region 48 64 N/A INTRINSIC
Blast:VWA 93 343 1e-109 BLAST
low complexity region 704 728 N/A INTRINSIC
low complexity region 762 775 N/A INTRINSIC
low complexity region 779 793 N/A INTRINSIC
low complexity region 875 887 N/A INTRINSIC
low complexity region 994 1011 N/A INTRINSIC
low complexity region 1351 1370 N/A INTRINSIC
low complexity region 1619 1630 N/A INTRINSIC
low complexity region 1662 1678 N/A INTRINSIC
low complexity region 1832 1854 N/A INTRINSIC
low complexity region 1862 1881 N/A INTRINSIC
low complexity region 1895 1914 N/A INTRINSIC
low complexity region 2176 2184 N/A INTRINSIC
low complexity region 2284 2292 N/A INTRINSIC
low complexity region 2309 2323 N/A INTRINSIC
low complexity region 2373 2384 N/A INTRINSIC
low complexity region 2500 2508 N/A INTRINSIC
low complexity region 2669 2680 N/A INTRINSIC
low complexity region 2739 2758 N/A INTRINSIC
low complexity region 3239 3252 N/A INTRINSIC
low complexity region 3257 3268 N/A INTRINSIC
low complexity region 3283 3309 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183402
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein associated with low seizure threshold in mice and may contribute to susceptibility to epilepsy. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for mutations in this gene display increased susceptibility to induced seizures. Mice homozygous for null mutations also display partial penetrance of prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A T 4: 42,972,379 T571S probably benign Het
1700022I11Rik A T 4: 42,973,252 I862F possibly damaging Het
4930563D23Rik T C 16: 92,320,822 I193V probably damaging Het
Aars2 G A 17: 45,507,624 D112N probably damaging Het
Abca7 T A 10: 80,009,944 I1580K probably damaging Het
Aebp1 A G 11: 5,865,059 D234G probably damaging Het
Agap1 T A 1: 89,455,431 M1K probably null Het
Agrn A T 4: 156,178,932 L345H probably damaging Het
Amfr A G 8: 93,999,126 M209T possibly damaging Het
Angel2 G A 1: 190,941,174 R338H possibly damaging Het
Ankrd27 C T 7: 35,631,249 A866V probably damaging Het
Apc G A 18: 34,315,271 R1740Q probably damaging Het
Arhgap32 A T 9: 32,256,937 S739C possibly damaging Het
Arhgap32 G C 9: 32,256,938 S739T probably benign Het
Arhgef2 C T 3: 88,635,885 S418L probably benign Het
Arhgef25 T C 10: 127,183,772 T472A possibly damaging Het
Atrnl1 C T 19: 57,650,414 S328F probably benign Het
Bahcc1 C T 11: 120,280,174 A1514V probably benign Het
Calcoco2 C T 11: 96,099,997 E305K unknown Het
Cdc42bpa A T 1: 180,061,797 K203* probably null Het
Cmc1 A T 9: 118,075,182 I47N possibly damaging Het
Cntln A G 4: 85,046,303 E656G possibly damaging Het
Cyr61 C T 3: 145,648,673 W161* probably null Het
Dcun1d3 T C 7: 119,859,641 K57R possibly damaging Het
Ddx23 T C 15: 98,648,611 E559G probably damaging Het
Dennd6a G A 14: 26,612,038 R367Q probably damaging Het
Desi2 A T 1: 178,256,136 probably benign Het
Dido1 T C 2: 180,659,631 D2160G unknown Het
Epb41 A G 4: 131,991,209 probably null Het
Esrrb T A 12: 86,470,557 probably null Het
Fabp1 C A 6: 71,203,127 T94N probably benign Het
Fam120a A T 13: 48,892,006 C785S probably damaging Het
Foxc1 A G 13: 31,807,260 Y18C probably damaging Het
Fshr T C 17: 88,985,844 T469A probably benign Het
Gm11639 T C 11: 105,038,358 M4838T probably benign Het
Gm14399 T A 2: 175,130,411 H517L unknown Het
Gm39115 G T 7: 142,135,560 Q159K unknown Het
Gm7347 T A 5: 26,057,308 I72F possibly damaging Het
Gm9573 G A 17: 35,618,869 A1475V unknown Het
Hmcn1 A G 1: 150,683,715 V2395A possibly damaging Het
Ighv5-17 T G 12: 113,859,238 T88P probably damaging Het
Insm2 T A 12: 55,600,544 Y358N probably damaging Het
Kazn A T 4: 142,117,175 L409Q Het
Kcnj5 A C 9: 32,322,749 L90R probably damaging Het
Kcnv2 A T 19: 27,333,684 T484S probably damaging Het
Kdm3b T C 18: 34,794,504 Y140H probably benign Het
Kif1bp A C 10: 62,566,116 C261W probably damaging Het
Krt25 C T 11: 99,321,272 A180T probably benign Het
Mmp1a A G 9: 7,467,293 E290G probably damaging Het
Nr3c1 T C 18: 39,414,601 T755A probably benign Het
Nr3c1 A T 18: 39,422,733 I517N probably benign Het
Nxpe2 A G 9: 48,323,039 probably null Het
Oaz1 C A 10: 80,826,839 T27K possibly damaging Het
Olfr1053 A G 2: 86,315,025 M87T probably benign Het
Olfr1093 G T 2: 86,786,690 C320F probably benign Het
Olfr1178 A T 2: 88,391,706 H153L probably damaging Het
Olfr1336 T A 7: 6,460,778 W90R probably benign Het
Olfr284 A G 15: 98,340,062 V309A probably damaging Het
Olfr561 T C 7: 102,775,427 I301T probably damaging Het
Pafah2 A T 4: 134,419,997 K319M probably damaging Het
Pask A T 1: 93,331,587 V236E probably damaging Het
Pcdh1 T C 18: 38,189,913 T956A probably damaging Het
Pcdhb18 C A 18: 37,490,647 N343K probably damaging Het
Pcsk2 A T 2: 143,690,423 I164F probably damaging Het
Phf1 T C 17: 26,935,315 Y169H probably damaging Het
Pkdrej T A 15: 85,821,100 I212F probably benign Het
Pnkp T A 7: 44,858,690 W146R probably damaging Het
Prkcb A T 7: 122,544,687 I325F probably benign Het
Ptpn21 C T 12: 98,704,191 D239N probably benign Het
Ptprb A G 10: 116,328,165 T626A probably damaging Het
Pttg1 T C 11: 43,421,089 N180D probably benign Het
Raly G A 2: 154,861,854 R115Q probably damaging Het
Rims2 A T 15: 39,437,718 M474L probably benign Het
Sash1 A T 10: 8,730,196 I810N probably damaging Het
Scnn1g T A 7: 121,738,081 L55* probably null Het
Sema6b A T 17: 56,125,573 D543E possibly damaging Het
Serpina11 C T 12: 103,986,502 G5E unknown Het
Sesn3 A T 9: 14,276,552 M1L probably benign Het
Sez6 T A 11: 77,974,323 I632N possibly damaging Het
Sgo2b A T 8: 63,941,158 I49N probably damaging Het
Slc30a2 A T 4: 134,344,213 I86F possibly damaging Het
Slc38a6 T A 12: 73,287,012 W30R probably benign Het
Stk31 T G 6: 49,438,459 V576G probably benign Het
Tmem208 T C 8: 105,334,786 F148S possibly damaging Het
Tprgl A G 4: 154,160,574 L19P possibly damaging Het
Tubg2 C A 11: 101,160,071 N207K probably damaging Het
Ube2n G T 10: 95,541,750 K130N probably benign Het
Usp36 T C 11: 118,273,529 Y384C probably damaging Het
Vcan A T 13: 89,692,733 L1564* probably null Het
Xkr6 A T 14: 63,798,299 D283V unknown Het
Zfp654 T C 16: 64,785,160 H352R probably benign Het
Zfp819 T A 7: 43,617,082 C330S probably damaging Het
Zfp970 G T 2: 177,475,293 C220F probably damaging Het
Other mutations in Szt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Szt2 APN 4 118384250 splice site probably benign
IGL01082:Szt2 APN 4 118397624 missense probably damaging 1.00
IGL01348:Szt2 APN 4 118393624 splice site probably benign
IGL01869:Szt2 APN 4 118399071 missense possibly damaging 0.87
IGL01918:Szt2 APN 4 118384253 splice site probably benign
IGL01951:Szt2 APN 4 118376493 unclassified probably benign
IGL01971:Szt2 APN 4 118386955 missense probably benign 0.01
IGL02047:Szt2 APN 4 118376637 unclassified probably benign
IGL02092:Szt2 APN 4 118363332 unclassified probably benign
IGL02120:Szt2 APN 4 118388564 missense probably benign 0.01
IGL02210:Szt2 APN 4 118389823 missense possibly damaging 0.95
IGL02435:Szt2 APN 4 118390823 missense probably damaging 1.00
IGL02622:Szt2 APN 4 118392890 missense probably damaging 0.96
IGL02666:Szt2 APN 4 118374055 missense probably damaging 0.99
IGL02712:Szt2 APN 4 118384833 missense probably benign 0.19
IGL02983:Szt2 APN 4 118365779 unclassified probably benign
IGL03026:Szt2 APN 4 118391849 missense probably benign 0.40
IGL03178:Szt2 APN 4 118382689 missense unknown
IGL03233:Szt2 APN 4 118372529 missense unknown
IGL03377:Szt2 APN 4 118402397 splice site probably benign
IGL03387:Szt2 APN 4 118364725 unclassified probably benign
PIT4687001:Szt2 UTSW 4 118398201 missense possibly damaging 0.84
R0026:Szt2 UTSW 4 118384772 missense possibly damaging 0.92
R0352:Szt2 UTSW 4 118382593 missense unknown
R0396:Szt2 UTSW 4 118376347 unclassified probably benign
R0504:Szt2 UTSW 4 118372952 splice site probably null
R1033:Szt2 UTSW 4 118387106 missense probably damaging 0.98
R1222:Szt2 UTSW 4 118405459 missense possibly damaging 0.77
R1418:Szt2 UTSW 4 118387779 missense probably benign 0.03
R1462:Szt2 UTSW 4 118373967 missense unknown
R1462:Szt2 UTSW 4 118373967 missense unknown
R1763:Szt2 UTSW 4 118372368 missense unknown
R1772:Szt2 UTSW 4 118405517 missense probably damaging 1.00
R1840:Szt2 UTSW 4 118365657 unclassified probably benign
R1942:Szt2 UTSW 4 118392620 missense probably benign 0.17
R1965:Szt2 UTSW 4 118383965 missense probably benign 0.36
R1998:Szt2 UTSW 4 118375727 critical splice donor site probably null
R2009:Szt2 UTSW 4 118378064 critical splice donor site probably null
R2012:Szt2 UTSW 4 118363665 unclassified probably benign
R2044:Szt2 UTSW 4 118376448 nonsense probably null
R2066:Szt2 UTSW 4 118373980 missense unknown
R2345:Szt2 UTSW 4 118381397 missense unknown
R2857:Szt2 UTSW 4 118369402 missense probably damaging 1.00
R3156:Szt2 UTSW 4 118402819 critical splice donor site probably null
R3236:Szt2 UTSW 4 118383034 splice site probably null
R3237:Szt2 UTSW 4 118383034 splice site probably null
R3405:Szt2 UTSW 4 118394020 missense probably benign 0.02
R3795:Szt2 UTSW 4 118391730 missense probably damaging 1.00
R3878:Szt2 UTSW 4 118390585 missense probably damaging 1.00
R3906:Szt2 UTSW 4 118378269 unclassified probably benign
R4012:Szt2 UTSW 4 118383900 missense probably benign 0.02
R4039:Szt2 UTSW 4 118364952 unclassified probably benign
R4081:Szt2 UTSW 4 118373567 splice site probably benign
R4298:Szt2 UTSW 4 118365406 unclassified probably benign
R4299:Szt2 UTSW 4 118365406 unclassified probably benign
R4432:Szt2 UTSW 4 118384231 missense probably damaging 0.99
R4597:Szt2 UTSW 4 118372681 missense unknown
R4657:Szt2 UTSW 4 118397669 missense probably benign 0.06
R4663:Szt2 UTSW 4 118377684 unclassified probably benign
R4670:Szt2 UTSW 4 118375829 unclassified probably benign
R4704:Szt2 UTSW 4 118393829 missense probably damaging 0.99
R4748:Szt2 UTSW 4 118389191 nonsense probably null
R4786:Szt2 UTSW 4 118399062 missense probably benign 0.20
R4809:Szt2 UTSW 4 118388985 missense probably damaging 1.00
R4830:Szt2 UTSW 4 118369248 missense unknown
R4944:Szt2 UTSW 4 118388669 missense probably benign 0.03
R5077:Szt2 UTSW 4 118369616 critical splice donor site probably null
R5121:Szt2 UTSW 4 118385444 missense possibly damaging 0.92
R5140:Szt2 UTSW 4 118386981 missense possibly damaging 0.46
R5169:Szt2 UTSW 4 118389830 missense probably benign 0.26
R5198:Szt2 UTSW 4 118388322 missense probably benign 0.03
R5433:Szt2 UTSW 4 118375466 unclassified probably benign
R5625:Szt2 UTSW 4 118373217 missense unknown
R5628:Szt2 UTSW 4 118373217 missense unknown
R5630:Szt2 UTSW 4 118392905 missense possibly damaging 0.83
R5808:Szt2 UTSW 4 118372613 missense unknown
R5902:Szt2 UTSW 4 118391503 missense probably benign 0.05
R6049:Szt2 UTSW 4 118402988 missense probably damaging 0.99
R6066:Szt2 UTSW 4 118371974 missense unknown
R6272:Szt2 UTSW 4 118374290 unclassified probably benign
R6456:Szt2 UTSW 4 118376697 unclassified probably benign
R6538:Szt2 UTSW 4 118390477 splice site probably null
R6604:Szt2 UTSW 4 118385474 missense probably benign 0.01
R6664:Szt2 UTSW 4 118391745 missense probably damaging 1.00
R6834:Szt2 UTSW 4 118388325 missense probably benign 0.01
R7109:Szt2 UTSW 4 118375479 missense unknown
R7163:Szt2 UTSW 4 118405530 missense possibly damaging 0.90
R7190:Szt2 UTSW 4 118389006 missense probably damaging 0.98
R7291:Szt2 UTSW 4 118391249 missense probably damaging 0.98
R7383:Szt2 UTSW 4 118365214 nonsense probably null
R7448:Szt2 UTSW 4 118363471 missense unknown
R7637:Szt2 UTSW 4 118393828 missense probably damaging 0.99
R7833:Szt2 UTSW 4 118366219 missense unknown
R7896:Szt2 UTSW 4 118402913 missense possibly damaging 0.62
R7916:Szt2 UTSW 4 118366219 missense unknown
R7979:Szt2 UTSW 4 118402913 missense possibly damaging 0.62
X0023:Szt2 UTSW 4 118372404 missense unknown
Z1176:Szt2 UTSW 4 118393976 missense probably damaging 0.99
Z1177:Szt2 UTSW 4 118391214 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGCACTGAGGGAACACTC -3'
(R):5'- CCCCGACTTGGACATCTACTTG -3'

Sequencing Primer
(F):5'- TGAGGGAACACTCCAGCC -3'
(R):5'- CTACTTGTATAATAAACCTGGTGGAC -3'
Posted On2019-06-26