Incidental Mutation 'R0635:Slc4a1'
ID 56623
Institutional Source Beutler Lab
Gene Symbol Slc4a1
Ensembl Gene ENSMUSG00000006574
Gene Name solute carrier family 4 (anion exchanger), member 1
Synonyms band 3, CD233, Ae1, erythrocyte membrane protein band 3, l11Jus51, Empb3
MMRRC Submission 038824-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0635 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 102239646-102256107 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 102243498 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 711 (E711G)
Ref Sequence ENSEMBL: ENSMUSP00000006749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006749]
AlphaFold P04919
Predicted Effect possibly damaging
Transcript: ENSMUST00000006749
AA Change: E711G

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000006749
Gene: ENSMUSG00000006574
AA Change: E711G

DomainStartEndE-ValueType
low complexity region 58 68 N/A INTRINSIC
Pfam:Band_3_cyto 100 342 1.6e-81 PFAM
Pfam:HCO3_cotransp 391 584 5.7e-85 PFAM
Pfam:HCO3_cotransp 575 857 5.6e-118 PFAM
transmembrane domain 875 892 N/A INTRINSIC
Meta Mutation Damage Score 0.5991 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.9%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of the anion exchanger (AE) family and is expressed in the erythrocyte plasma membrane, where it functions as a chloride/bicarbonate exchanger involved in carbon dioxide transport from tissues to lungs. The protein comprises two domains that are structurally and functionally distinct. The N-terminal 40kDa domain is located in the cytoplasm and acts as an attachment site for the red cell skeleton by binding ankyrin. The glycosylated C-terminal membrane-associated domain contains 12-14 membrane spanning segments and carries out the stilbene disulphonate-sensitive exchange transport of anions. The cytoplasmic tail at the extreme C-terminus of the membrane domain binds carbonic anhydrase II. The encoded protein associates with the red cell membrane protein glycophorin A and this association promotes the correct folding and translocation of the exchanger. This protein is predominantly dimeric but forms tetramers in the presence of ankyrin. Many mutations in this gene are known in man, and these mutations can lead to two types of disease: destabilization of red cell membrane leading to hereditary spherocytosis, and defective kidney acid secretion leading to distal renal tubular acidosis. Other mutations that do not give rise to disease result in novel blood group antigens, which form the Diego blood group system. Southeast Asian ovalocytosis (SAO, Melanesian ovalocytosis) results from the heterozygous presence of a deletion in the encoded protein and is common in areas where Plasmodium falciparum malaria is endemic. One null mutation in this gene is known, resulting in very severe anemia and nephrocalcinosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for null mutations exhibit retarded growth, severe spherocytosis, hemolytic anemia, lack of erythrocyte glycophorin A, mitotic defects, and high postnatal mortality. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, knock-out(3) Targeted, other(1) Spontaneous(1) Chemically induced(1)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730455P16Rik A T 11: 80,264,891 (GRCm39) probably benign Het
Adamts15 A G 9: 30,816,066 (GRCm39) L631P probably damaging Het
Adamts17 T C 7: 66,558,353 (GRCm39) F266L probably damaging Het
Adgrb1 C A 15: 74,412,741 (GRCm39) Q488K possibly damaging Het
Armh4 A G 14: 50,010,600 (GRCm39) L369S probably benign Het
Cep290 A G 10: 100,328,538 (GRCm39) D109G probably damaging Het
Chil5 A T 3: 105,924,519 (GRCm39) Y229N possibly damaging Het
Cntnap1 A G 11: 101,074,285 (GRCm39) T742A probably benign Het
Col6a3 A T 1: 90,735,808 (GRCm39) probably null Het
Col6a5 G A 9: 105,805,805 (GRCm39) P1034S unknown Het
Daxx T A 17: 34,131,618 (GRCm39) D442E probably benign Het
Dmxl1 T C 18: 49,984,490 (GRCm39) probably benign Het
Dnah11 A G 12: 117,971,731 (GRCm39) F2942S probably damaging Het
Garin4 T C 1: 190,895,924 (GRCm39) T240A probably benign Het
Glg1 A G 8: 111,890,396 (GRCm39) probably benign Het
Gm10272 G A 10: 77,542,535 (GRCm39) probably benign Het
Gm17333 AAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAA AAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAA 16: 77,649,766 (GRCm39) noncoding transcript Het
Haao A G 17: 84,146,003 (GRCm39) F83S probably damaging Het
Hdgfl2 T A 17: 56,403,057 (GRCm39) L177Q probably damaging Het
Hrh1 T C 6: 114,457,106 (GRCm39) V129A probably damaging Het
Ift43 T A 12: 86,131,855 (GRCm39) probably benign Het
Il21r T C 7: 125,231,678 (GRCm39) Y369H probably damaging Het
Il2ra C T 2: 11,685,177 (GRCm39) T171M probably benign Het
Lao1 C T 4: 118,825,493 (GRCm39) R438C probably benign Het
Lrrcc1 G A 3: 14,624,288 (GRCm39) S350N probably benign Het
Mageb5 T A X: 90,823,599 (GRCm39) Y260F probably benign Het
Marchf5 A T 19: 37,197,807 (GRCm39) I159F possibly damaging Het
Mgat4a G A 1: 37,491,375 (GRCm39) A282V probably benign Het
Mipep G A 14: 61,066,839 (GRCm39) V420I probably damaging Het
Morc2b A T 17: 33,356,661 (GRCm39) F370L possibly damaging Het
Mt1 A T 8: 94,906,449 (GRCm39) probably null Het
Ncapd2 A G 6: 125,149,999 (GRCm39) V943A probably benign Het
Nkd2 T C 13: 73,975,013 (GRCm39) D58G probably benign Het
Nol8 C G 13: 49,830,234 (GRCm39) S1106C probably benign Het
Nrm C A 17: 36,175,156 (GRCm39) Y61* probably null Het
Nusap1 A G 2: 119,458,148 (GRCm39) T95A probably damaging Het
Ocln T A 13: 100,642,744 (GRCm39) Q197L probably damaging Het
Or5p70 T A 7: 107,994,971 (GRCm39) F215I probably benign Het
Oxtr A G 6: 112,466,161 (GRCm39) Y200H probably damaging Het
Paip2b T C 6: 83,786,891 (GRCm39) E115G possibly damaging Het
Pcm1 T A 8: 41,720,216 (GRCm39) probably benign Het
Pcnt T C 10: 76,240,419 (GRCm39) D1205G probably damaging Het
Phka1 G A X: 101,665,006 (GRCm39) R186C probably damaging Het
Pik3cb A G 9: 98,946,271 (GRCm39) probably benign Het
Pik3r1 C T 13: 101,893,926 (GRCm39) R81K probably benign Het
Ppa1 A G 10: 61,501,219 (GRCm39) D162G probably benign Het
Ppa1 A G 10: 61,502,749 (GRCm39) R191G probably damaging Het
Ppp4r3c2 T C X: 88,796,128 (GRCm39) probably benign Het
Prss22 T A 17: 24,215,662 (GRCm39) T87S probably benign Het
Rgr T A 14: 36,760,904 (GRCm39) R218* probably null Het
Rreb1 A T 13: 38,125,540 (GRCm39) Q1282L possibly damaging Het
Scel T A 14: 103,820,575 (GRCm39) probably null Het
Sema6b A G 17: 56,436,971 (GRCm39) probably null Het
Snx19 C A 9: 30,340,106 (GRCm39) L415M probably damaging Het
Snx19 T G 9: 30,340,107 (GRCm39) L415R probably damaging Het
Specc1 G A 11: 62,009,729 (GRCm39) R495Q probably damaging Het
Tead1 T C 7: 112,490,913 (GRCm39) probably benign Het
Timm10b A C 7: 105,289,895 (GRCm39) probably benign Het
Ubxn7 T A 16: 32,186,235 (GRCm39) probably benign Het
Vmn2r116 T A 17: 23,605,861 (GRCm39) Y258N possibly damaging Het
Vmn2r77 T A 7: 86,460,383 (GRCm39) F570I probably benign Het
Vmn2r98 T C 17: 19,300,759 (GRCm39) V587A probably benign Het
Zfp398 T C 6: 47,840,074 (GRCm39) I101T probably damaging Het
Zfp808 T A 13: 62,320,233 (GRCm39) H487Q probably damaging Het
Other mutations in Slc4a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01303:Slc4a1 APN 11 102,248,790 (GRCm39) missense probably benign 0.09
IGL01845:Slc4a1 APN 11 102,244,729 (GRCm39) missense probably benign 0.01
IGL02166:Slc4a1 APN 11 102,245,159 (GRCm39) missense probably damaging 1.00
IGL02745:Slc4a1 APN 11 102,247,093 (GRCm39) missense probably damaging 1.00
IGL02801:Slc4a1 APN 11 102,249,972 (GRCm39) critical splice acceptor site probably null
Rumor UTSW 11 102,252,048 (GRCm39) nonsense probably null
A5278:Slc4a1 UTSW 11 102,244,641 (GRCm39) splice site probably benign
R0011:Slc4a1 UTSW 11 102,247,936 (GRCm39) missense possibly damaging 0.51
R0193:Slc4a1 UTSW 11 102,243,510 (GRCm39) missense possibly damaging 0.91
R0445:Slc4a1 UTSW 11 102,245,192 (GRCm39) missense probably benign 0.04
R0599:Slc4a1 UTSW 11 102,248,741 (GRCm39) splice site probably benign
R1496:Slc4a1 UTSW 11 102,251,997 (GRCm39) missense probably benign
R1816:Slc4a1 UTSW 11 102,242,056 (GRCm39) missense probably damaging 1.00
R1898:Slc4a1 UTSW 11 102,241,133 (GRCm39) missense probably damaging 1.00
R2361:Slc4a1 UTSW 11 102,247,656 (GRCm39) missense probably damaging 1.00
R2381:Slc4a1 UTSW 11 102,250,128 (GRCm39) missense probably benign 0.00
R3806:Slc4a1 UTSW 11 102,248,019 (GRCm39) missense probably benign 0.00
R3857:Slc4a1 UTSW 11 102,247,947 (GRCm39) missense probably benign 0.01
R3858:Slc4a1 UTSW 11 102,247,947 (GRCm39) missense probably benign 0.01
R4585:Slc4a1 UTSW 11 102,252,245 (GRCm39) utr 5 prime probably benign
R4586:Slc4a1 UTSW 11 102,252,245 (GRCm39) utr 5 prime probably benign
R4705:Slc4a1 UTSW 11 102,247,084 (GRCm39) missense possibly damaging 0.89
R4914:Slc4a1 UTSW 11 102,243,279 (GRCm39) missense probably damaging 1.00
R4915:Slc4a1 UTSW 11 102,243,279 (GRCm39) missense probably damaging 1.00
R4916:Slc4a1 UTSW 11 102,243,279 (GRCm39) missense probably damaging 1.00
R4918:Slc4a1 UTSW 11 102,243,279 (GRCm39) missense probably damaging 1.00
R5001:Slc4a1 UTSW 11 102,242,329 (GRCm39) missense probably benign 0.12
R5103:Slc4a1 UTSW 11 102,244,087 (GRCm39) missense possibly damaging 0.65
R5234:Slc4a1 UTSW 11 102,252,209 (GRCm39) missense probably benign 0.03
R5308:Slc4a1 UTSW 11 102,249,903 (GRCm39) missense probably damaging 0.98
R5315:Slc4a1 UTSW 11 102,249,080 (GRCm39) missense possibly damaging 0.77
R5478:Slc4a1 UTSW 11 102,241,140 (GRCm39) missense probably damaging 0.98
R5521:Slc4a1 UTSW 11 102,244,092 (GRCm39) missense probably benign 0.01
R5888:Slc4a1 UTSW 11 102,247,351 (GRCm39) missense probably damaging 0.98
R6011:Slc4a1 UTSW 11 102,243,357 (GRCm39) missense probably damaging 1.00
R6547:Slc4a1 UTSW 11 102,247,561 (GRCm39) missense probably damaging 0.99
R6629:Slc4a1 UTSW 11 102,252,048 (GRCm39) nonsense probably null
R6717:Slc4a1 UTSW 11 102,245,249 (GRCm39) missense probably damaging 0.99
R7051:Slc4a1 UTSW 11 102,247,084 (GRCm39) missense probably benign 0.12
R7103:Slc4a1 UTSW 11 102,244,693 (GRCm39) missense probably damaging 0.97
R7315:Slc4a1 UTSW 11 102,247,310 (GRCm39) missense probably damaging 1.00
R7331:Slc4a1 UTSW 11 102,252,245 (GRCm39) start gained probably benign
R7582:Slc4a1 UTSW 11 102,243,403 (GRCm39) missense probably damaging 0.99
R8560:Slc4a1 UTSW 11 102,244,083 (GRCm39) missense possibly damaging 0.94
R9036:Slc4a1 UTSW 11 102,243,279 (GRCm39) missense probably damaging 1.00
R9274:Slc4a1 UTSW 11 102,242,047 (GRCm39) missense probably benign 0.00
R9502:Slc4a1 UTSW 11 102,247,674 (GRCm39) missense probably damaging 0.97
R9568:Slc4a1 UTSW 11 102,247,680 (GRCm39) missense probably damaging 1.00
R9585:Slc4a1 UTSW 11 102,247,915 (GRCm39) missense probably benign 0.08
R9651:Slc4a1 UTSW 11 102,242,256 (GRCm39) missense probably damaging 1.00
RF006:Slc4a1 UTSW 11 102,247,542 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TTCCCCATGACTGTGAGGGCATTG -3'
(R):5'- AACTGGGAGCTATGAGCTTCGCTG -3'

Sequencing Primer
(F):5'- GCATTGGCGTGGGTAACAG -3'
(R):5'- AGGGTATTCCAGAGACTTCTAGCC -3'
Posted On 2013-07-11