Incidental Mutation 'R7289:Sgo2b'
ID566237
Institutional Source Beutler Lab
Gene Symbol Sgo2b
Ensembl Gene ENSMUSG00000094443
Gene Nameshugoshin 2B
SynonymsSgol2b, Gm4975
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R7289 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location63924694-63952248 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 63941158 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 49 (I49N)
Ref Sequence ENSEMBL: ENSMUSP00000136323 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000179944]
Predicted Effect probably damaging
Transcript: ENSMUST00000179944
AA Change: I49N

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000136323
Gene: ENSMUSG00000094443
AA Change: I49N

DomainStartEndE-ValueType
coiled coil region 54 113 N/A INTRINSIC
low complexity region 122 135 N/A INTRINSIC
low complexity region 163 172 N/A INTRINSIC
low complexity region 400 414 N/A INTRINSIC
internal_repeat_1 528 618 9.12e-8 PROSPERO
internal_repeat_1 713 809 9.12e-8 PROSPERO
low complexity region 1009 1024 N/A INTRINSIC
low complexity region 1059 1081 N/A INTRINSIC
low complexity region 1112 1126 N/A INTRINSIC
low complexity region 1130 1148 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A T 4: 42,972,379 T571S probably benign Het
1700022I11Rik A T 4: 42,973,252 I862F possibly damaging Het
4930563D23Rik T C 16: 92,320,822 I193V probably damaging Het
Aars2 G A 17: 45,507,624 D112N probably damaging Het
Abca7 T A 10: 80,009,944 I1580K probably damaging Het
Aebp1 A G 11: 5,865,059 D234G probably damaging Het
Agap1 T A 1: 89,455,431 M1K probably null Het
Agrn A T 4: 156,178,932 L345H probably damaging Het
Amfr A G 8: 93,999,126 M209T possibly damaging Het
Angel2 G A 1: 190,941,174 R338H possibly damaging Het
Ankrd27 C T 7: 35,631,249 A866V probably damaging Het
Apc G A 18: 34,315,271 R1740Q probably damaging Het
Arhgap32 A T 9: 32,256,937 S739C possibly damaging Het
Arhgap32 G C 9: 32,256,938 S739T probably benign Het
Arhgef2 C T 3: 88,635,885 S418L probably benign Het
Arhgef25 T C 10: 127,183,772 T472A possibly damaging Het
Atrnl1 C T 19: 57,650,414 S328F probably benign Het
Bahcc1 C T 11: 120,280,174 A1514V probably benign Het
Calcoco2 C T 11: 96,099,997 E305K unknown Het
Cdc42bpa A T 1: 180,061,797 K203* probably null Het
Cmc1 A T 9: 118,075,182 I47N possibly damaging Het
Cntln A G 4: 85,046,303 E656G possibly damaging Het
Cyr61 C T 3: 145,648,673 W161* probably null Het
Dcun1d3 T C 7: 119,859,641 K57R possibly damaging Het
Ddx23 T C 15: 98,648,611 E559G probably damaging Het
Dennd6a G A 14: 26,612,038 R367Q probably damaging Het
Desi2 A T 1: 178,256,136 probably benign Het
Dido1 T C 2: 180,659,631 D2160G unknown Het
Epb41 A G 4: 131,991,209 probably null Het
Esrrb T A 12: 86,470,557 probably null Het
Fabp1 C A 6: 71,203,127 T94N probably benign Het
Fam120a A T 13: 48,892,006 C785S probably damaging Het
Foxc1 A G 13: 31,807,260 Y18C probably damaging Het
Fshr T C 17: 88,985,844 T469A probably benign Het
Gm11639 T C 11: 105,038,358 M4838T probably benign Het
Gm14399 T A 2: 175,130,411 H517L unknown Het
Gm39115 G T 7: 142,135,560 Q159K unknown Het
Gm7347 T A 5: 26,057,308 I72F possibly damaging Het
Gm9573 G A 17: 35,618,869 A1475V unknown Het
Hmcn1 A G 1: 150,683,715 V2395A possibly damaging Het
Ighv5-17 T G 12: 113,859,238 T88P probably damaging Het
Insm2 T A 12: 55,600,544 Y358N probably damaging Het
Kazn A T 4: 142,117,175 L409Q Het
Kcnj5 A C 9: 32,322,749 L90R probably damaging Het
Kcnv2 A T 19: 27,333,684 T484S probably damaging Het
Kdm3b T C 18: 34,794,504 Y140H probably benign Het
Kif1bp A C 10: 62,566,116 C261W probably damaging Het
Krt25 C T 11: 99,321,272 A180T probably benign Het
Mmp1a A G 9: 7,467,293 E290G probably damaging Het
Nr3c1 T C 18: 39,414,601 T755A probably benign Het
Nr3c1 A T 18: 39,422,733 I517N probably benign Het
Nxpe2 A G 9: 48,323,039 probably null Het
Oaz1 C A 10: 80,826,839 T27K possibly damaging Het
Olfr1053 A G 2: 86,315,025 M87T probably benign Het
Olfr1093 G T 2: 86,786,690 C320F probably benign Het
Olfr1178 A T 2: 88,391,706 H153L probably damaging Het
Olfr1336 T A 7: 6,460,778 W90R probably benign Het
Olfr284 A G 15: 98,340,062 V309A probably damaging Het
Olfr561 T C 7: 102,775,427 I301T probably damaging Het
Pafah2 A T 4: 134,419,997 K319M probably damaging Het
Pask A T 1: 93,331,587 V236E probably damaging Het
Pcdh1 T C 18: 38,189,913 T956A probably damaging Het
Pcdhb18 C A 18: 37,490,647 N343K probably damaging Het
Pcsk2 A T 2: 143,690,423 I164F probably damaging Het
Phf1 T C 17: 26,935,315 Y169H probably damaging Het
Pkdrej T A 15: 85,821,100 I212F probably benign Het
Pnkp T A 7: 44,858,690 W146R probably damaging Het
Prkcb A T 7: 122,544,687 I325F probably benign Het
Ptpn21 C T 12: 98,704,191 D239N probably benign Het
Ptprb A G 10: 116,328,165 T626A probably damaging Het
Pttg1 T C 11: 43,421,089 N180D probably benign Het
Raly G A 2: 154,861,854 R115Q probably damaging Het
Rims2 A T 15: 39,437,718 M474L probably benign Het
Sash1 A T 10: 8,730,196 I810N probably damaging Het
Scnn1g T A 7: 121,738,081 L55* probably null Het
Sema6b A T 17: 56,125,573 D543E possibly damaging Het
Serpina11 C T 12: 103,986,502 G5E unknown Het
Sesn3 A T 9: 14,276,552 M1L probably benign Het
Sez6 T A 11: 77,974,323 I632N possibly damaging Het
Slc30a2 A T 4: 134,344,213 I86F possibly damaging Het
Slc38a6 T A 12: 73,287,012 W30R probably benign Het
Stk31 T G 6: 49,438,459 V576G probably benign Het
Szt2 G A 4: 118,375,878 T2297I unknown Het
Tmem208 T C 8: 105,334,786 F148S possibly damaging Het
Tprgl A G 4: 154,160,574 L19P possibly damaging Het
Tubg2 C A 11: 101,160,071 N207K probably damaging Het
Ube2n G T 10: 95,541,750 K130N probably benign Het
Usp36 T C 11: 118,273,529 Y384C probably damaging Het
Vcan A T 13: 89,692,733 L1564* probably null Het
Xkr6 A T 14: 63,798,299 D283V unknown Het
Zfp654 T C 16: 64,785,160 H352R probably benign Het
Zfp819 T A 7: 43,617,082 C330S probably damaging Het
Zfp970 G T 2: 177,475,293 C220F probably damaging Het
Other mutations in Sgo2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Sgo2b APN 8 63926523 missense probably benign
IGL01343:Sgo2b APN 8 63927315 nonsense probably null
IGL02027:Sgo2b APN 8 63926829 missense probably benign
IGL02090:Sgo2b APN 8 63927089 missense probably damaging 0.99
IGL02121:Sgo2b APN 8 63931282 missense possibly damaging 0.94
IGL02206:Sgo2b APN 8 63941084 missense possibly damaging 0.94
IGL02554:Sgo2b APN 8 63926537 missense probably damaging 0.96
IGL02663:Sgo2b APN 8 63943114 missense probably damaging 0.97
IGL03149:Sgo2b APN 8 63926583 missense probably benign 0.14
floater UTSW 8 63938417 nonsense probably null
R0164:Sgo2b UTSW 8 63938383 missense possibly damaging 0.92
R0164:Sgo2b UTSW 8 63938383 missense possibly damaging 0.92
R0201:Sgo2b UTSW 8 63926636 missense probably benign
R0285:Sgo2b UTSW 8 63928789 nonsense probably null
R0325:Sgo2b UTSW 8 63928376 missense probably benign 0.20
R0727:Sgo2b UTSW 8 63927782 missense probably damaging 0.98
R0943:Sgo2b UTSW 8 63931335 missense possibly damaging 0.82
R1148:Sgo2b UTSW 8 63926855 missense probably damaging 0.99
R1266:Sgo2b UTSW 8 63928421 missense probably benign 0.00
R1484:Sgo2b UTSW 8 63931473 missense possibly damaging 0.77
R1493:Sgo2b UTSW 8 63926855 missense probably damaging 0.99
R1537:Sgo2b UTSW 8 63926502 missense possibly damaging 0.94
R1630:Sgo2b UTSW 8 63927797 missense possibly damaging 0.90
R1803:Sgo2b UTSW 8 63927392 missense probably benign 0.01
R1912:Sgo2b UTSW 8 63931469 missense probably damaging 0.98
R1993:Sgo2b UTSW 8 63926833 missense probably benign 0.36
R2042:Sgo2b UTSW 8 63928527 missense probably benign
R2130:Sgo2b UTSW 8 63927147 missense probably benign 0.09
R2146:Sgo2b UTSW 8 63928023 missense probably benign 0.00
R2881:Sgo2b UTSW 8 63927536 missense probably damaging 0.99
R3686:Sgo2b UTSW 8 63931327 missense probably benign 0.20
R3706:Sgo2b UTSW 8 63928145 missense probably damaging 0.98
R3889:Sgo2b UTSW 8 63927743 missense possibly damaging 0.82
R3894:Sgo2b UTSW 8 63928733 missense possibly damaging 0.91
R3895:Sgo2b UTSW 8 63928733 missense possibly damaging 0.91
R4058:Sgo2b UTSW 8 63926947 missense probably damaging 0.98
R4259:Sgo2b UTSW 8 63928296 missense probably benign 0.06
R4260:Sgo2b UTSW 8 63928296 missense probably benign 0.06
R4704:Sgo2b UTSW 8 63927790 missense probably damaging 0.98
R4815:Sgo2b UTSW 8 63931414 missense probably benign
R4922:Sgo2b UTSW 8 63926630 missense possibly damaging 0.66
R5232:Sgo2b UTSW 8 63928602 missense possibly damaging 0.55
R5262:Sgo2b UTSW 8 63943137 missense probably damaging 0.99
R5444:Sgo2b UTSW 8 63926556 missense possibly damaging 0.90
R5677:Sgo2b UTSW 8 63926974 missense possibly damaging 0.77
R5959:Sgo2b UTSW 8 63927288 missense probably benign 0.01
R6004:Sgo2b UTSW 8 63926673 nonsense probably null
R6267:Sgo2b UTSW 8 63927793 missense probably benign
R6296:Sgo2b UTSW 8 63927793 missense probably benign
R6328:Sgo2b UTSW 8 63928311 nonsense probably null
R6517:Sgo2b UTSW 8 63931494 missense probably damaging 0.99
R6523:Sgo2b UTSW 8 63927504 missense probably benign 0.11
R6726:Sgo2b UTSW 8 63927735 nonsense probably null
R6957:Sgo2b UTSW 8 63931455 small deletion probably benign
R7031:Sgo2b UTSW 8 63940044 missense possibly damaging 0.94
R7034:Sgo2b UTSW 8 63926834 missense probably benign 0.36
R7145:Sgo2b UTSW 8 63928184 missense probably damaging 1.00
R7366:Sgo2b UTSW 8 63938417 nonsense probably null
R7660:Sgo2b UTSW 8 63940074 missense probably benign 0.27
R7761:Sgo2b UTSW 8 63926912 missense probably benign
R7762:Sgo2b UTSW 8 63926497 missense probably benign 0.03
R7822:Sgo2b UTSW 8 63927284 missense probably damaging 0.98
R8111:Sgo2b UTSW 8 63943104 missense probably damaging 0.98
R8129:Sgo2b UTSW 8 63928800 missense possibly damaging 0.90
RF014:Sgo2b UTSW 8 63931405 missense possibly damaging 0.94
RF055:Sgo2b UTSW 8 63943169 missense probably damaging 1.00
Z1088:Sgo2b UTSW 8 63927005 missense probably damaging 1.00
Z1088:Sgo2b UTSW 8 63928422 missense possibly damaging 0.61
Z1177:Sgo2b UTSW 8 63927439 missense probably benign 0.03
Z1177:Sgo2b UTSW 8 63928385 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- CCCAAGAGGTGTCTATCCTTTAG -3'
(R):5'- TCTTCACTTTTAAGATCTGGGCAC -3'

Sequencing Primer
(F):5'- GGAGAGTCCAAAACAATACAATTTCC -3'
(R):5'- CCAACTGTCACTTGATGTCTA -3'
Posted On2019-06-26