Incidental Mutation 'R7289:Sgo2b'
ID 566237
Institutional Source Beutler Lab
Gene Symbol Sgo2b
Ensembl Gene ENSMUSG00000094443
Gene Name shugoshin 2B
Synonyms Sgol2b, Gm4975
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock # R7289 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 63924694-63952248 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 63941158 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 49 (I49N)
Ref Sequence ENSEMBL: ENSMUSP00000136323 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000179944]
AlphaFold J3QMK1
Predicted Effect probably damaging
Transcript: ENSMUST00000179944
AA Change: I49N

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000136323
Gene: ENSMUSG00000094443
AA Change: I49N

DomainStartEndE-ValueType
coiled coil region 54 113 N/A INTRINSIC
low complexity region 122 135 N/A INTRINSIC
low complexity region 163 172 N/A INTRINSIC
low complexity region 400 414 N/A INTRINSIC
internal_repeat_1 528 618 9.12e-8 PROSPERO
internal_repeat_1 713 809 9.12e-8 PROSPERO
low complexity region 1009 1024 N/A INTRINSIC
low complexity region 1059 1081 N/A INTRINSIC
low complexity region 1112 1126 N/A INTRINSIC
low complexity region 1130 1148 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A T 4: 42,972,379 T571S probably benign Het
1700022I11Rik A T 4: 42,973,252 I862F possibly damaging Het
4930563D23Rik T C 16: 92,320,822 I193V probably damaging Het
Aars2 G A 17: 45,507,624 D112N probably damaging Het
Abca7 T A 10: 80,009,944 I1580K probably damaging Het
Aebp1 A G 11: 5,865,059 D234G probably damaging Het
Agap1 T A 1: 89,455,431 M1K probably null Het
Agrn A T 4: 156,178,932 L345H probably damaging Het
Amfr A G 8: 93,999,126 M209T possibly damaging Het
Angel2 G A 1: 190,941,174 R338H possibly damaging Het
Ankrd27 C T 7: 35,631,249 A866V probably damaging Het
Apc G A 18: 34,315,271 R1740Q probably damaging Het
Arhgap32 A T 9: 32,256,937 S739C possibly damaging Het
Arhgap32 G C 9: 32,256,938 S739T probably benign Het
Arhgef2 C T 3: 88,635,885 S418L probably benign Het
Arhgef25 T C 10: 127,183,772 T472A possibly damaging Het
Atrnl1 C T 19: 57,650,414 S328F probably benign Het
Bahcc1 C T 11: 120,280,174 A1514V probably benign Het
Calcoco2 C T 11: 96,099,997 E305K unknown Het
Cdc42bpa A T 1: 180,061,797 K203* probably null Het
Cmc1 A T 9: 118,075,182 I47N possibly damaging Het
Cntln A G 4: 85,046,303 E656G possibly damaging Het
Cyr61 C T 3: 145,648,673 W161* probably null Het
Dcun1d3 T C 7: 119,859,641 K57R possibly damaging Het
Ddx23 T C 15: 98,648,611 E559G probably damaging Het
Dennd6a G A 14: 26,612,038 R367Q probably damaging Het
Desi2 A T 1: 178,256,136 probably benign Het
Dido1 T C 2: 180,659,631 D2160G unknown Het
Epb41 A G 4: 131,991,209 probably null Het
Esrrb T A 12: 86,470,557 probably null Het
Fabp1 C A 6: 71,203,127 T94N probably benign Het
Fam120a A T 13: 48,892,006 C785S probably damaging Het
Foxc1 A G 13: 31,807,260 Y18C probably damaging Het
Fshr T C 17: 88,985,844 T469A probably benign Het
Gm11639 T C 11: 105,038,358 M4838T probably benign Het
Gm14399 T A 2: 175,130,411 H517L unknown Het
Gm39115 G T 7: 142,135,560 Q159K unknown Het
Gm7347 T A 5: 26,057,308 I72F possibly damaging Het
Gm9573 G A 17: 35,618,869 A1475V unknown Het
Hmcn1 A G 1: 150,683,715 V2395A possibly damaging Het
Ighv5-17 T G 12: 113,859,238 T88P probably damaging Het
Insm2 T A 12: 55,600,544 Y358N probably damaging Het
Kazn A T 4: 142,117,175 L409Q Het
Kcnj5 A C 9: 32,322,749 L90R probably damaging Het
Kcnv2 A T 19: 27,333,684 T484S probably damaging Het
Kdm3b T C 18: 34,794,504 Y140H probably benign Het
Kif1bp A C 10: 62,566,116 C261W probably damaging Het
Krt25 C T 11: 99,321,272 A180T probably benign Het
Mmp1a A G 9: 7,467,293 E290G probably damaging Het
Nr3c1 T C 18: 39,414,601 T755A probably benign Het
Nr3c1 A T 18: 39,422,733 I517N probably benign Het
Nxpe2 A G 9: 48,323,039 probably null Het
Oaz1 C A 10: 80,826,839 T27K possibly damaging Het
Olfr1053 A G 2: 86,315,025 M87T probably benign Het
Olfr1093 G T 2: 86,786,690 C320F probably benign Het
Olfr1178 A T 2: 88,391,706 H153L probably damaging Het
Olfr1336 T A 7: 6,460,778 W90R probably benign Het
Olfr284 A G 15: 98,340,062 V309A probably damaging Het
Olfr561 T C 7: 102,775,427 I301T probably damaging Het
Pafah2 A T 4: 134,419,997 K319M probably damaging Het
Pask A T 1: 93,331,587 V236E probably damaging Het
Pcdh1 T C 18: 38,189,913 T956A probably damaging Het
Pcdhb18 C A 18: 37,490,647 N343K probably damaging Het
Pcsk2 A T 2: 143,690,423 I164F probably damaging Het
Phf1 T C 17: 26,935,315 Y169H probably damaging Het
Pkdrej T A 15: 85,821,100 I212F probably benign Het
Pnkp T A 7: 44,858,690 W146R probably damaging Het
Prkcb A T 7: 122,544,687 I325F probably benign Het
Ptpn21 C T 12: 98,704,191 D239N probably benign Het
Ptprb A G 10: 116,328,165 T626A probably damaging Het
Pttg1 T C 11: 43,421,089 N180D probably benign Het
Raly G A 2: 154,861,854 R115Q probably damaging Het
Rims2 A T 15: 39,437,718 M474L probably benign Het
Sash1 A T 10: 8,730,196 I810N probably damaging Het
Scnn1g T A 7: 121,738,081 L55* probably null Het
Sema6b A T 17: 56,125,573 D543E possibly damaging Het
Serpina11 C T 12: 103,986,502 G5E unknown Het
Sesn3 A T 9: 14,276,552 M1L probably benign Het
Sez6 T A 11: 77,974,323 I632N possibly damaging Het
Slc30a2 A T 4: 134,344,213 I86F possibly damaging Het
Slc38a6 T A 12: 73,287,012 W30R probably benign Het
Stk31 T G 6: 49,438,459 V576G probably benign Het
Szt2 G A 4: 118,375,878 T2297I unknown Het
Tmem208 T C 8: 105,334,786 F148S possibly damaging Het
Tprgl A G 4: 154,160,574 L19P possibly damaging Het
Tubg2 C A 11: 101,160,071 N207K probably damaging Het
Ube2n G T 10: 95,541,750 K130N probably benign Het
Usp36 T C 11: 118,273,529 Y384C probably damaging Het
Vcan A T 13: 89,692,733 L1564* probably null Het
Xkr6 A T 14: 63,798,299 D283V unknown Het
Zfp654 T C 16: 64,785,160 H352R probably benign Het
Zfp819 T A 7: 43,617,082 C330S probably damaging Het
Zfp970 G T 2: 177,475,293 C220F probably damaging Het
Other mutations in Sgo2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Sgo2b APN 8 63926523 missense probably benign
IGL01343:Sgo2b APN 8 63927315 nonsense probably null
IGL02027:Sgo2b APN 8 63926829 missense probably benign
IGL02090:Sgo2b APN 8 63927089 missense probably damaging 0.99
IGL02121:Sgo2b APN 8 63931282 missense possibly damaging 0.94
IGL02206:Sgo2b APN 8 63941084 missense possibly damaging 0.94
IGL02554:Sgo2b APN 8 63926537 missense probably damaging 0.96
IGL02663:Sgo2b APN 8 63943114 missense probably damaging 0.97
IGL03149:Sgo2b APN 8 63926583 missense probably benign 0.14
floater UTSW 8 63938417 nonsense probably null
R0164:Sgo2b UTSW 8 63938383 missense possibly damaging 0.92
R0164:Sgo2b UTSW 8 63938383 missense possibly damaging 0.92
R0201:Sgo2b UTSW 8 63926636 missense probably benign
R0285:Sgo2b UTSW 8 63928789 nonsense probably null
R0325:Sgo2b UTSW 8 63928376 missense probably benign 0.20
R0727:Sgo2b UTSW 8 63927782 missense probably damaging 0.98
R0943:Sgo2b UTSW 8 63931335 missense possibly damaging 0.82
R1148:Sgo2b UTSW 8 63926855 missense probably damaging 0.99
R1266:Sgo2b UTSW 8 63928421 missense probably benign 0.00
R1484:Sgo2b UTSW 8 63931473 missense possibly damaging 0.77
R1493:Sgo2b UTSW 8 63926855 missense probably damaging 0.99
R1537:Sgo2b UTSW 8 63926502 missense possibly damaging 0.94
R1630:Sgo2b UTSW 8 63927797 missense possibly damaging 0.90
R1803:Sgo2b UTSW 8 63927392 missense probably benign 0.01
R1912:Sgo2b UTSW 8 63931469 missense probably damaging 0.98
R1993:Sgo2b UTSW 8 63926833 missense probably benign 0.36
R2042:Sgo2b UTSW 8 63928527 missense probably benign
R2130:Sgo2b UTSW 8 63927147 missense probably benign 0.09
R2146:Sgo2b UTSW 8 63928023 missense probably benign 0.00
R2881:Sgo2b UTSW 8 63927536 missense probably damaging 0.99
R3686:Sgo2b UTSW 8 63931327 missense probably benign 0.20
R3706:Sgo2b UTSW 8 63928145 missense probably damaging 0.98
R3889:Sgo2b UTSW 8 63927743 missense possibly damaging 0.82
R3894:Sgo2b UTSW 8 63928733 missense possibly damaging 0.91
R3895:Sgo2b UTSW 8 63928733 missense possibly damaging 0.91
R4058:Sgo2b UTSW 8 63926947 missense probably damaging 0.98
R4259:Sgo2b UTSW 8 63928296 missense probably benign 0.06
R4260:Sgo2b UTSW 8 63928296 missense probably benign 0.06
R4704:Sgo2b UTSW 8 63927790 missense probably damaging 0.98
R4815:Sgo2b UTSW 8 63931414 missense probably benign
R4922:Sgo2b UTSW 8 63926630 missense possibly damaging 0.66
R5232:Sgo2b UTSW 8 63928602 missense possibly damaging 0.55
R5262:Sgo2b UTSW 8 63943137 missense probably damaging 0.99
R5444:Sgo2b UTSW 8 63926556 missense possibly damaging 0.90
R5677:Sgo2b UTSW 8 63926974 missense possibly damaging 0.77
R5959:Sgo2b UTSW 8 63927288 missense probably benign 0.01
R6004:Sgo2b UTSW 8 63926673 nonsense probably null
R6267:Sgo2b UTSW 8 63927793 missense probably benign
R6296:Sgo2b UTSW 8 63927793 missense probably benign
R6328:Sgo2b UTSW 8 63928311 nonsense probably null
R6517:Sgo2b UTSW 8 63931494 missense probably damaging 0.99
R6523:Sgo2b UTSW 8 63927504 missense probably benign 0.11
R6726:Sgo2b UTSW 8 63927735 nonsense probably null
R6957:Sgo2b UTSW 8 63931455 small deletion probably benign
R7031:Sgo2b UTSW 8 63940044 missense possibly damaging 0.94
R7034:Sgo2b UTSW 8 63926834 missense probably benign 0.36
R7145:Sgo2b UTSW 8 63928184 missense probably damaging 1.00
R7366:Sgo2b UTSW 8 63938417 nonsense probably null
R7660:Sgo2b UTSW 8 63940074 missense probably benign 0.27
R7761:Sgo2b UTSW 8 63926912 missense probably benign
R7762:Sgo2b UTSW 8 63926497 missense probably benign 0.03
R7822:Sgo2b UTSW 8 63927284 missense probably damaging 0.98
R8111:Sgo2b UTSW 8 63943104 missense probably damaging 0.98
R8129:Sgo2b UTSW 8 63928800 missense possibly damaging 0.90
R8856:Sgo2b UTSW 8 63940057 missense probably null 0.99
R9249:Sgo2b UTSW 8 63938373 nonsense probably null
R9428:Sgo2b UTSW 8 63940033 missense probably damaging 0.99
RF014:Sgo2b UTSW 8 63931405 missense possibly damaging 0.94
RF055:Sgo2b UTSW 8 63943169 missense probably damaging 1.00
Z1088:Sgo2b UTSW 8 63927005 missense probably damaging 1.00
Z1088:Sgo2b UTSW 8 63928422 missense possibly damaging 0.61
Z1177:Sgo2b UTSW 8 63927439 missense probably benign 0.03
Z1177:Sgo2b UTSW 8 63928385 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- CCCAAGAGGTGTCTATCCTTTAG -3'
(R):5'- TCTTCACTTTTAAGATCTGGGCAC -3'

Sequencing Primer
(F):5'- GGAGAGTCCAAAACAATACAATTTCC -3'
(R):5'- CCAACTGTCACTTGATGTCTA -3'
Posted On 2019-06-26