Incidental Mutation 'R7289:Sash1'
ID566247
Institutional Source Beutler Lab
Gene Symbol Sash1
Ensembl Gene ENSMUSG00000015305
Gene NameSAM and SH3 domain containing 1
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7289 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location8722219-8886070 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 8730196 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 810 (I810N)
Ref Sequence ENSEMBL: ENSMUSP00000015449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015449]
Predicted Effect probably damaging
Transcript: ENSMUST00000015449
AA Change: I810N

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000015449
Gene: ENSMUSG00000015305
AA Change: I810N

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
coiled coil region 185 212 N/A INTRINSIC
low complexity region 323 336 N/A INTRINSIC
Pfam:SLY 394 548 1.2e-46 PFAM
SH3 550 607 1.16e-3 SMART
SAM 623 690 1.83e-11 SMART
low complexity region 1008 1021 N/A INTRINSIC
SAM 1157 1224 3.6e-10 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a scaffold protein involved in the TLR4 signaling pathway that may stimulate cytokine production and endothelial cell migration in response to invading pathogens. The encoded protein has also been described as a potential tumor suppressor that may negatively regulate proliferation, apoptosis, and invasion of cancer cells, and reduced expression of this gene has been observed in multiple human cancers. Mutations in this gene may be associated with abnormal skin pigmentation in human patients. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A T 4: 42,972,379 T571S probably benign Het
1700022I11Rik A T 4: 42,973,252 I862F possibly damaging Het
4930563D23Rik T C 16: 92,320,822 I193V probably damaging Het
Aars2 G A 17: 45,507,624 D112N probably damaging Het
Abca7 T A 10: 80,009,944 I1580K probably damaging Het
Aebp1 A G 11: 5,865,059 D234G probably damaging Het
Agap1 T A 1: 89,455,431 M1K probably null Het
Agrn A T 4: 156,178,932 L345H probably damaging Het
Amfr A G 8: 93,999,126 M209T possibly damaging Het
Angel2 G A 1: 190,941,174 R338H possibly damaging Het
Ankrd27 C T 7: 35,631,249 A866V probably damaging Het
Apc G A 18: 34,315,271 R1740Q probably damaging Het
Arhgap32 A T 9: 32,256,937 S739C possibly damaging Het
Arhgap32 G C 9: 32,256,938 S739T probably benign Het
Arhgef2 C T 3: 88,635,885 S418L probably benign Het
Arhgef25 T C 10: 127,183,772 T472A possibly damaging Het
Atrnl1 C T 19: 57,650,414 S328F probably benign Het
Bahcc1 C T 11: 120,280,174 A1514V probably benign Het
Calcoco2 C T 11: 96,099,997 E305K unknown Het
Cdc42bpa A T 1: 180,061,797 K203* probably null Het
Cmc1 A T 9: 118,075,182 I47N possibly damaging Het
Cntln A G 4: 85,046,303 E656G possibly damaging Het
Cyr61 C T 3: 145,648,673 W161* probably null Het
Dcun1d3 T C 7: 119,859,641 K57R possibly damaging Het
Ddx23 T C 15: 98,648,611 E559G probably damaging Het
Dennd6a G A 14: 26,612,038 R367Q probably damaging Het
Desi2 A T 1: 178,256,136 probably benign Het
Dido1 T C 2: 180,659,631 D2160G unknown Het
Epb41 A G 4: 131,991,209 probably null Het
Esrrb T A 12: 86,470,557 probably null Het
Fabp1 C A 6: 71,203,127 T94N probably benign Het
Fam120a A T 13: 48,892,006 C785S probably damaging Het
Foxc1 A G 13: 31,807,260 Y18C probably damaging Het
Fshr T C 17: 88,985,844 T469A probably benign Het
Gm11639 T C 11: 105,038,358 M4838T probably benign Het
Gm14399 T A 2: 175,130,411 H517L unknown Het
Gm39115 G T 7: 142,135,560 Q159K unknown Het
Gm7347 T A 5: 26,057,308 I72F possibly damaging Het
Gm9573 G A 17: 35,618,869 A1475V unknown Het
Hmcn1 A G 1: 150,683,715 V2395A possibly damaging Het
Ighv5-17 T G 12: 113,859,238 T88P probably damaging Het
Insm2 T A 12: 55,600,544 Y358N probably damaging Het
Kazn A T 4: 142,117,175 L409Q Het
Kcnj5 A C 9: 32,322,749 L90R probably damaging Het
Kcnv2 A T 19: 27,333,684 T484S probably damaging Het
Kdm3b T C 18: 34,794,504 Y140H probably benign Het
Kif1bp A C 10: 62,566,116 C261W probably damaging Het
Krt25 C T 11: 99,321,272 A180T probably benign Het
Mmp1a A G 9: 7,467,293 E290G probably damaging Het
Nr3c1 T C 18: 39,414,601 T755A probably benign Het
Nr3c1 A T 18: 39,422,733 I517N probably benign Het
Nxpe2 A G 9: 48,323,039 probably null Het
Oaz1 C A 10: 80,826,839 T27K possibly damaging Het
Olfr1053 A G 2: 86,315,025 M87T probably benign Het
Olfr1093 G T 2: 86,786,690 C320F probably benign Het
Olfr1178 A T 2: 88,391,706 H153L probably damaging Het
Olfr1336 T A 7: 6,460,778 W90R probably benign Het
Olfr284 A G 15: 98,340,062 V309A probably damaging Het
Olfr561 T C 7: 102,775,427 I301T probably damaging Het
Pafah2 A T 4: 134,419,997 K319M probably damaging Het
Pask A T 1: 93,331,587 V236E probably damaging Het
Pcdh1 T C 18: 38,189,913 T956A probably damaging Het
Pcdhb18 C A 18: 37,490,647 N343K probably damaging Het
Pcsk2 A T 2: 143,690,423 I164F probably damaging Het
Phf1 T C 17: 26,935,315 Y169H probably damaging Het
Pkdrej T A 15: 85,821,100 I212F probably benign Het
Pnkp T A 7: 44,858,690 W146R probably damaging Het
Prkcb A T 7: 122,544,687 I325F probably benign Het
Ptpn21 C T 12: 98,704,191 D239N probably benign Het
Ptprb A G 10: 116,328,165 T626A probably damaging Het
Pttg1 T C 11: 43,421,089 N180D probably benign Het
Raly G A 2: 154,861,854 R115Q probably damaging Het
Rims2 A T 15: 39,437,718 M474L probably benign Het
Scnn1g T A 7: 121,738,081 L55* probably null Het
Sema6b A T 17: 56,125,573 D543E possibly damaging Het
Serpina11 C T 12: 103,986,502 G5E unknown Het
Sesn3 A T 9: 14,276,552 M1L probably benign Het
Sez6 T A 11: 77,974,323 I632N possibly damaging Het
Sgo2b A T 8: 63,941,158 I49N probably damaging Het
Slc30a2 A T 4: 134,344,213 I86F possibly damaging Het
Slc38a6 T A 12: 73,287,012 W30R probably benign Het
Stk31 T G 6: 49,438,459 V576G probably benign Het
Szt2 G A 4: 118,375,878 T2297I unknown Het
Tmem208 T C 8: 105,334,786 F148S possibly damaging Het
Tprgl A G 4: 154,160,574 L19P possibly damaging Het
Tubg2 C A 11: 101,160,071 N207K probably damaging Het
Ube2n G T 10: 95,541,750 K130N probably benign Het
Usp36 T C 11: 118,273,529 Y384C probably damaging Het
Vcan A T 13: 89,692,733 L1564* probably null Het
Xkr6 A T 14: 63,798,299 D283V unknown Het
Zfp654 T C 16: 64,785,160 H352R probably benign Het
Zfp819 T A 7: 43,617,082 C330S probably damaging Het
Zfp970 G T 2: 177,475,293 C220F probably damaging Het
Other mutations in Sash1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00987:Sash1 APN 10 8751413 missense probably damaging 1.00
IGL01535:Sash1 APN 10 8741577 missense probably damaging 1.00
IGL01537:Sash1 APN 10 8729658 missense probably damaging 1.00
IGL01788:Sash1 APN 10 8733646 missense probably benign 0.01
IGL01933:Sash1 APN 10 8751133 missense probably damaging 0.99
IGL02126:Sash1 APN 10 8739465 missense probably damaging 0.96
IGL02285:Sash1 APN 10 8740334 missense probably damaging 0.99
IGL02400:Sash1 APN 10 8733647 nonsense probably null
IGL02504:Sash1 APN 10 8729912 missense probably benign 0.00
IGL02630:Sash1 APN 10 8744535 missense probably benign 0.06
R0592:Sash1 UTSW 10 8729782 missense probably benign 0.00
R0647:Sash1 UTSW 10 8729552 missense probably damaging 0.99
R0656:Sash1 UTSW 10 8751137 critical splice donor site probably null
R0830:Sash1 UTSW 10 8729909 missense probably benign 0.01
R0919:Sash1 UTSW 10 8730079 missense probably benign 0.01
R1470:Sash1 UTSW 10 8789593 missense probably damaging 1.00
R1470:Sash1 UTSW 10 8789593 missense probably damaging 1.00
R1606:Sash1 UTSW 10 8729957 missense probably benign 0.00
R1707:Sash1 UTSW 10 8730377 missense probably benign 0.00
R1922:Sash1 UTSW 10 8727908 missense possibly damaging 0.62
R1940:Sash1 UTSW 10 8729932 missense probably benign
R1964:Sash1 UTSW 10 8729713 missense probably benign 0.01
R2013:Sash1 UTSW 10 8729413 missense probably benign 0.03
R2014:Sash1 UTSW 10 8729413 missense probably benign 0.03
R2015:Sash1 UTSW 10 8729413 missense probably benign 0.03
R2074:Sash1 UTSW 10 8756697 missense probably damaging 1.00
R2252:Sash1 UTSW 10 8729977 missense probably benign 0.01
R2253:Sash1 UTSW 10 8729977 missense probably benign 0.01
R2260:Sash1 UTSW 10 8786378 nonsense probably null
R3085:Sash1 UTSW 10 8742422 splice site probably null
R4024:Sash1 UTSW 10 8729917 missense probably benign 0.00
R4039:Sash1 UTSW 10 8729627 missense probably damaging 1.00
R4290:Sash1 UTSW 10 8730242 missense possibly damaging 0.59
R4292:Sash1 UTSW 10 8730242 missense possibly damaging 0.59
R4295:Sash1 UTSW 10 8730242 missense possibly damaging 0.59
R4301:Sash1 UTSW 10 8751470 missense probably benign 0.00
R4657:Sash1 UTSW 10 8725660 missense probably damaging 1.00
R4669:Sash1 UTSW 10 8730385 missense probably benign 0.00
R4719:Sash1 UTSW 10 8729713 missense probably benign 0.01
R4745:Sash1 UTSW 10 8729908 missense probably benign
R5197:Sash1 UTSW 10 8740225 missense probably damaging 1.00
R5217:Sash1 UTSW 10 8780604 missense possibly damaging 0.63
R5420:Sash1 UTSW 10 8746186 missense probably damaging 1.00
R5591:Sash1 UTSW 10 8725718 missense probably benign 0.36
R6505:Sash1 UTSW 10 8729527 missense probably benign 0.21
R6679:Sash1 UTSW 10 8740185 missense probably damaging 1.00
R6761:Sash1 UTSW 10 8744522 missense probably damaging 0.99
R6885:Sash1 UTSW 10 8784221 missense probably damaging 1.00
R6980:Sash1 UTSW 10 8729848 missense probably benign 0.00
R7034:Sash1 UTSW 10 8730083 nonsense probably null
R7036:Sash1 UTSW 10 8730083 nonsense probably null
R7088:Sash1 UTSW 10 8729717 nonsense probably null
R7464:Sash1 UTSW 10 8756745 missense possibly damaging 0.82
R7661:Sash1 UTSW 10 8729391 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGTCAGAAGCATCACATCTGC -3'
(R):5'- TTTCACCAGGAGTCAGCCAG -3'

Sequencing Primer
(F):5'- ACATCTGCTGTGGGATCTCG -3'
(R):5'- CAGGAGTCAGCCAGGCAAC -3'
Posted On2019-06-26