Incidental Mutation 'R7289:Gm9573'
ID 566281
Institutional Source Beutler Lab
Gene Symbol Gm9573
Ensembl Gene ENSMUSG00000090588
Gene Name predicted gene 9573
Synonyms Muc21, epiglycanin
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock # R7289 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 35617923-35626637 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 35618869 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 1475 (A1475V)
Ref Sequence ENSEMBL: ENSMUSP00000130987 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164502] [ENSMUST00000174521]
AlphaFold F7C950
Predicted Effect unknown
Transcript: ENSMUST00000164502
AA Change: A1475V
SMART Domains Protein: ENSMUSP00000130987
Gene: ENSMUSG00000090588
AA Change: A1475V

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 26 39 N/A INTRINSIC
low complexity region 42 59 N/A INTRINSIC
low complexity region 76 144 N/A INTRINSIC
low complexity region 149 578 N/A INTRINSIC
low complexity region 580 653 N/A INTRINSIC
low complexity region 655 1179 N/A INTRINSIC
low complexity region 1183 1373 N/A INTRINSIC
low complexity region 1383 1436 N/A INTRINSIC
low complexity region 1438 1479 N/A INTRINSIC
Pfam:Epiglycanin_C 1518 1605 3.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174521
SMART Domains Protein: ENSMUSP00000134221
Gene: ENSMUSG00000090509

DomainStartEndE-ValueType
Pfam:SFTA2 80 117 9.2e-18 PFAM
Meta Mutation Damage Score 0.0852 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A T 4: 42,973,252 I862F possibly damaging Het
1700022I11Rik A T 4: 42,972,379 T571S probably benign Het
4930563D23Rik T C 16: 92,320,822 I193V probably damaging Het
Aars2 G A 17: 45,507,624 D112N probably damaging Het
Abca7 T A 10: 80,009,944 I1580K probably damaging Het
Aebp1 A G 11: 5,865,059 D234G probably damaging Het
Agap1 T A 1: 89,455,431 M1K probably null Het
Agrn A T 4: 156,178,932 L345H probably damaging Het
Amfr A G 8: 93,999,126 M209T possibly damaging Het
Angel2 G A 1: 190,941,174 R338H possibly damaging Het
Ankrd27 C T 7: 35,631,249 A866V probably damaging Het
Apc G A 18: 34,315,271 R1740Q probably damaging Het
Arhgap32 A T 9: 32,256,937 S739C possibly damaging Het
Arhgap32 G C 9: 32,256,938 S739T probably benign Het
Arhgef2 C T 3: 88,635,885 S418L probably benign Het
Arhgef25 T C 10: 127,183,772 T472A possibly damaging Het
Atrnl1 C T 19: 57,650,414 S328F probably benign Het
Bahcc1 C T 11: 120,280,174 A1514V probably benign Het
Calcoco2 C T 11: 96,099,997 E305K unknown Het
Cdc42bpa A T 1: 180,061,797 K203* probably null Het
Cmc1 A T 9: 118,075,182 I47N possibly damaging Het
Cntln A G 4: 85,046,303 E656G possibly damaging Het
Cyr61 C T 3: 145,648,673 W161* probably null Het
Dcun1d3 T C 7: 119,859,641 K57R possibly damaging Het
Ddx23 T C 15: 98,648,611 E559G probably damaging Het
Dennd6a G A 14: 26,612,038 R367Q probably damaging Het
Desi2 A T 1: 178,256,136 probably benign Het
Dido1 T C 2: 180,659,631 D2160G unknown Het
Epb41 A G 4: 131,991,209 probably null Het
Esrrb T A 12: 86,470,557 probably null Het
Fabp1 C A 6: 71,203,127 T94N probably benign Het
Fam120a A T 13: 48,892,006 C785S probably damaging Het
Foxc1 A G 13: 31,807,260 Y18C probably damaging Het
Fshr T C 17: 88,985,844 T469A probably benign Het
Gm11639 T C 11: 105,038,358 M4838T probably benign Het
Gm14399 T A 2: 175,130,411 H517L unknown Het
Gm39115 G T 7: 142,135,560 Q159K unknown Het
Gm7347 T A 5: 26,057,308 I72F possibly damaging Het
Hmcn1 A G 1: 150,683,715 V2395A possibly damaging Het
Ighv5-17 T G 12: 113,859,238 T88P probably damaging Het
Insm2 T A 12: 55,600,544 Y358N probably damaging Het
Kazn A T 4: 142,117,175 L409Q Het
Kcnj5 A C 9: 32,322,749 L90R probably damaging Het
Kcnv2 A T 19: 27,333,684 T484S probably damaging Het
Kdm3b T C 18: 34,794,504 Y140H probably benign Het
Kif1bp A C 10: 62,566,116 C261W probably damaging Het
Krt25 C T 11: 99,321,272 A180T probably benign Het
Mmp1a A G 9: 7,467,293 E290G probably damaging Het
Nr3c1 T C 18: 39,414,601 T755A probably benign Het
Nr3c1 A T 18: 39,422,733 I517N probably benign Het
Nxpe2 A G 9: 48,323,039 probably null Het
Oaz1 C A 10: 80,826,839 T27K possibly damaging Het
Olfr1053 A G 2: 86,315,025 M87T probably benign Het
Olfr1093 G T 2: 86,786,690 C320F probably benign Het
Olfr1178 A T 2: 88,391,706 H153L probably damaging Het
Olfr1336 T A 7: 6,460,778 W90R probably benign Het
Olfr284 A G 15: 98,340,062 V309A probably damaging Het
Olfr561 T C 7: 102,775,427 I301T probably damaging Het
Pafah2 A T 4: 134,419,997 K319M probably damaging Het
Pask A T 1: 93,331,587 V236E probably damaging Het
Pcdh1 T C 18: 38,189,913 T956A probably damaging Het
Pcdhb18 C A 18: 37,490,647 N343K probably damaging Het
Pcsk2 A T 2: 143,690,423 I164F probably damaging Het
Phf1 T C 17: 26,935,315 Y169H probably damaging Het
Pkdrej T A 15: 85,821,100 I212F probably benign Het
Pnkp T A 7: 44,858,690 W146R probably damaging Het
Prkcb A T 7: 122,544,687 I325F probably benign Het
Ptpn21 C T 12: 98,704,191 D239N probably benign Het
Ptprb A G 10: 116,328,165 T626A probably damaging Het
Pttg1 T C 11: 43,421,089 N180D probably benign Het
Raly G A 2: 154,861,854 R115Q probably damaging Het
Rims2 A T 15: 39,437,718 M474L probably benign Het
Sash1 A T 10: 8,730,196 I810N probably damaging Het
Scnn1g T A 7: 121,738,081 L55* probably null Het
Sema6b A T 17: 56,125,573 D543E possibly damaging Het
Serpina11 C T 12: 103,986,502 G5E unknown Het
Sesn3 A T 9: 14,276,552 M1L probably benign Het
Sez6 T A 11: 77,974,323 I632N possibly damaging Het
Sgo2b A T 8: 63,941,158 I49N probably damaging Het
Slc30a2 A T 4: 134,344,213 I86F possibly damaging Het
Slc38a6 T A 12: 73,287,012 W30R probably benign Het
Stk31 T G 6: 49,438,459 V576G probably benign Het
Szt2 G A 4: 118,375,878 T2297I unknown Het
Tmem208 T C 8: 105,334,786 F148S possibly damaging Het
Tprgl A G 4: 154,160,574 L19P possibly damaging Het
Tubg2 C A 11: 101,160,071 N207K probably damaging Het
Ube2n G T 10: 95,541,750 K130N probably benign Het
Usp36 T C 11: 118,273,529 Y384C probably damaging Het
Vcan A T 13: 89,692,733 L1564* probably null Het
Xkr6 A T 14: 63,798,299 D283V unknown Het
Zfp654 T C 16: 64,785,160 H352R probably benign Het
Zfp819 T A 7: 43,617,082 C330S probably damaging Het
Zfp970 G T 2: 177,475,293 C220F probably damaging Het
Other mutations in Gm9573
AlleleSourceChrCoordTypePredicted EffectPPH Score
BB009:Gm9573 UTSW 17 35622633 intron probably benign
FR4304:Gm9573 UTSW 17 35622121 intron probably benign
R0334:Gm9573 UTSW 17 35622722 intron probably benign
R0946:Gm9573 UTSW 17 35618213 missense probably benign 0.32
R1117:Gm9573 UTSW 17 35620028 intron probably benign
R1345:Gm9573 UTSW 17 35621597 intron probably benign
R1697:Gm9573 UTSW 17 35620648 intron probably benign
R1750:Gm9573 UTSW 17 35621048 intron probably benign
R1756:Gm9573 UTSW 17 35619239 intron probably benign
R1946:Gm9573 UTSW 17 35622524 intron probably benign
R1978:Gm9573 UTSW 17 35622965 intron probably benign
R1991:Gm9573 UTSW 17 35618708 missense probably benign 0.32
R1992:Gm9573 UTSW 17 35618708 missense probably benign 0.32
R2063:Gm9573 UTSW 17 35621405 intron probably benign
R2356:Gm9573 UTSW 17 35621671 intron probably benign
R2866:Gm9573 UTSW 17 35619707 intron probably benign
R3826:Gm9573 UTSW 17 35621612 intron probably benign
R4020:Gm9573 UTSW 17 35620061 intron probably benign
R4474:Gm9573 UTSW 17 35620604 intron probably benign
R4677:Gm9573 UTSW 17 35619707 intron probably benign
R4786:Gm9573 UTSW 17 35619329 intron probably benign
R5071:Gm9573 UTSW 17 35620552 intron probably benign
R5173:Gm9573 UTSW 17 35620741 intron probably benign
R5283:Gm9573 UTSW 17 35621332 intron probably benign
R5446:Gm9573 UTSW 17 35622503 intron probably benign
R5542:Gm9573 UTSW 17 35622503 intron probably benign
R5716:Gm9573 UTSW 17 35620783 intron probably benign
R5913:Gm9573 UTSW 17 35623231 intron probably benign
R6011:Gm9573 UTSW 17 35622182 intron probably benign
R6198:Gm9573 UTSW 17 35620916 intron probably benign
R6394:Gm9573 UTSW 17 35620166 intron probably benign
R6786:Gm9573 UTSW 17 35623165 intron probably benign
R6940:Gm9573 UTSW 17 35623226 intron probably benign
R7082:Gm9573 UTSW 17 35621201 missense unknown
R7103:Gm9573 UTSW 17 35621540 missense unknown
R7110:Gm9573 UTSW 17 35622618 intron probably benign
R7139:Gm9573 UTSW 17 35622633 intron probably benign
R7165:Gm9573 UTSW 17 35621978 missense unknown
R7200:Gm9573 UTSW 17 35622633 intron probably benign
R7204:Gm9573 UTSW 17 35621213 intron probably benign
R7290:Gm9573 UTSW 17 35618869 missense unknown
R7295:Gm9573 UTSW 17 35618869 missense unknown
R7319:Gm9573 UTSW 17 35622043 intron probably benign
R7462:Gm9573 UTSW 17 35620676 missense unknown
R7529:Gm9573 UTSW 17 35619231 missense unknown
R7718:Gm9573 UTSW 17 35622836 missense unknown
R7762:Gm9573 UTSW 17 35622085 missense unknown
R7788:Gm9573 UTSW 17 35618906 missense unknown
R7798:Gm9573 UTSW 17 35621254 missense unknown
R7831:Gm9573 UTSW 17 35618759 missense unknown
R7896:Gm9573 UTSW 17 35620025 missense unknown
R7899:Gm9573 UTSW 17 35620601 intron probably benign
R7932:Gm9573 UTSW 17 35622633 intron probably benign
R8025:Gm9573 UTSW 17 35620987 intron probably benign
R8077:Gm9573 UTSW 17 35619736 intron probably benign
R8090:Gm9573 UTSW 17 35621725 missense unknown
R8169:Gm9573 UTSW 17 35621180 missense unknown
R8184:Gm9573 UTSW 17 35622830 missense unknown
R8209:Gm9573 UTSW 17 35619707 intron probably benign
R8226:Gm9573 UTSW 17 35619707 intron probably benign
R8464:Gm9573 UTSW 17 35622206 intron probably benign
R8670:Gm9573 UTSW 17 35621648 missense unknown
R8783:Gm9573 UTSW 17 35619983 missense unknown
R8856:Gm9573 UTSW 17 35620973 missense unknown
R9155:Gm9573 UTSW 17 35621239 missense unknown
R9214:Gm9573 UTSW 17 35620946 missense unknown
R9353:Gm9573 UTSW 17 35619653 missense unknown
RF025:Gm9573 UTSW 17 35622879 intron probably benign
Z1176:Gm9573 UTSW 17 35621245 missense unknown
Z1177:Gm9573 UTSW 17 35620925 missense unknown
Z1177:Gm9573 UTSW 17 35621059 missense unknown
Predicted Primers PCR Primer
(F):5'- ATGACCACGATAACAGAGGC -3'
(R):5'- AGACCTCTGCATCTTCACTCAG -3'

Sequencing Primer
(F):5'- AAGATTTCCCAGGGCTTCAG -3'
(R):5'- GCTTGACCTCCACTATGACCAG -3'
Posted On 2019-06-26