Incidental Mutation 'R0635:Nkd2'
ID56629
Institutional Source Beutler Lab
Gene Symbol Nkd2
Ensembl Gene ENSMUSG00000021567
Gene Namenaked cuticle 2
Synonyms2210403L10Rik
MMRRC Submission 038824-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0635 (G1)
Quality Score163
Status Validated
Chromosome13
Chromosomal Location73818534-73847631 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 73826894 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 58 (D58G)
Ref Sequence ENSEMBL: ENSMUSP00000113794 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022051] [ENSMUST00000118096] [ENSMUST00000222004]
Predicted Effect probably benign
Transcript: ENSMUST00000022051
AA Change: D70G

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000022051
Gene: ENSMUSG00000021567
AA Change: D70G

DomainStartEndE-ValueType
SCOP:d1alva_ 133 160 7e-3 SMART
low complexity region 341 358 N/A INTRINSIC
low complexity region 380 390 N/A INTRINSIC
low complexity region 441 459 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118096
AA Change: D58G

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000113794
Gene: ENSMUSG00000021567
AA Change: D58G

DomainStartEndE-ValueType
SCOP:d1alva_ 121 148 7e-3 SMART
low complexity region 329 346 N/A INTRINSIC
low complexity region 368 378 N/A INTRINSIC
low complexity region 429 447 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138899
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139696
Predicted Effect probably benign
Transcript: ENSMUST00000222004
Meta Mutation Damage Score 0.1153 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.9%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins that function as negative regulators of Wnt receptor signaling through interaction with Dishevelled family members. The encoded protein participates in the delivery of transforming growth factor alpha-containing vesicles to the cell membrane. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for a reporter allele are viable and fertile but show a slight and background-sensitive reduction in average litter size relative to control mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik A G 14: 49,773,143 L369S probably benign Het
4932429P05Rik T C X: 89,752,522 probably benign Het
5730455P16Rik A T 11: 80,374,065 probably benign Het
Adamts15 A G 9: 30,904,770 L631P probably damaging Het
Adamts17 T C 7: 66,908,605 F266L probably damaging Het
Adgrb1 C A 15: 74,540,892 Q488K possibly damaging Het
Cep290 A G 10: 100,492,676 D109G probably damaging Het
Chil5 A T 3: 106,017,203 Y229N possibly damaging Het
Cntnap1 A G 11: 101,183,459 T742A probably benign Het
Col6a3 A T 1: 90,808,086 probably null Het
Col6a5 G A 9: 105,928,606 P1034S unknown Het
Daxx T A 17: 33,912,644 D442E probably benign Het
Dmxl1 T C 18: 49,851,423 probably benign Het
Dnah11 A G 12: 118,007,996 F2942S probably damaging Het
Fam71a T C 1: 191,163,727 T240A probably benign Het
Glg1 A G 8: 111,163,764 probably benign Het
Gm10272 G A 10: 77,706,701 probably benign Het
Gm17333 AAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAA AAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAA 16: 77,852,878 noncoding transcript Het
Haao A G 17: 83,838,574 F83S probably damaging Het
Hdgfl2 T A 17: 56,096,057 L177Q probably damaging Het
Hrh1 T C 6: 114,480,145 V129A probably damaging Het
Ift43 T A 12: 86,085,081 probably benign Het
Il21r T C 7: 125,632,506 Y369H probably damaging Het
Il2ra C T 2: 11,680,366 T171M probably benign Het
Lao1 C T 4: 118,968,296 R438C probably benign Het
Lrrcc1 G A 3: 14,559,228 S350N probably benign Het
Mageb5 T A X: 91,779,993 Y260F probably benign Het
March5 A T 19: 37,220,408 I159F possibly damaging Het
Mgat4a G A 1: 37,452,294 A282V probably benign Het
Mipep G A 14: 60,829,390 V420I probably damaging Het
Morc2b A T 17: 33,137,687 F370L possibly damaging Het
Mt1 A T 8: 94,179,821 probably null Het
Ncapd2 A G 6: 125,173,036 V943A probably benign Het
Nol8 C G 13: 49,676,758 S1106C probably benign Het
Nrm C A 17: 35,864,264 Y61* probably null Het
Nusap1 A G 2: 119,627,667 T95A probably damaging Het
Ocln T A 13: 100,506,236 Q197L probably damaging Het
Olfr495 T A 7: 108,395,764 F215I probably benign Het
Oxtr A G 6: 112,489,200 Y200H probably damaging Het
Paip2b T C 6: 83,809,909 E115G possibly damaging Het
Pcm1 T A 8: 41,267,179 probably benign Het
Pcnt T C 10: 76,404,585 D1205G probably damaging Het
Phka1 G A X: 102,621,400 R186C probably damaging Het
Pik3cb A G 9: 99,064,218 probably benign Het
Pik3r1 C T 13: 101,757,418 R81K probably benign Het
Ppa1 A G 10: 61,665,440 D162G probably benign Het
Ppa1 A G 10: 61,666,970 R191G probably damaging Het
Prss22 T A 17: 23,996,688 T87S probably benign Het
Rgr T A 14: 37,038,947 R218* probably null Het
Rreb1 A T 13: 37,941,564 Q1282L possibly damaging Het
Scel T A 14: 103,583,139 probably null Het
Sema6b A G 17: 56,129,971 probably null Het
Slc4a1 T C 11: 102,352,672 E711G possibly damaging Het
Snx19 C A 9: 30,428,810 L415M probably damaging Het
Snx19 T G 9: 30,428,811 L415R probably damaging Het
Specc1 G A 11: 62,118,903 R495Q probably damaging Het
Tead1 T C 7: 112,891,706 probably benign Het
Timm10b A C 7: 105,640,688 probably benign Het
Ubxn7 T A 16: 32,367,417 probably benign Het
Vmn2r116 T A 17: 23,386,887 Y258N possibly damaging Het
Vmn2r77 T A 7: 86,811,175 F570I probably benign Het
Vmn2r98 T C 17: 19,080,497 V587A probably benign Het
Zfp398 T C 6: 47,863,140 I101T probably damaging Het
Zfp808 T A 13: 62,172,419 H487Q probably damaging Het
Other mutations in Nkd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01583:Nkd2 APN 13 73821480 missense probably benign 0.01
IGL03121:Nkd2 APN 13 73821379 missense probably benign 0.11
R4062:Nkd2 UTSW 13 73822690 missense probably null 1.00
R4546:Nkd2 UTSW 13 73823356 missense probably benign 0.02
R4724:Nkd2 UTSW 13 73847005 missense probably damaging 0.99
R4934:Nkd2 UTSW 13 73822722 missense probably damaging 1.00
R5051:Nkd2 UTSW 13 73825076 missense probably benign 0.06
R5353:Nkd2 UTSW 13 73821438 missense probably damaging 0.99
R6228:Nkd2 UTSW 13 73821460 missense probably benign 0.00
R6242:Nkd2 UTSW 13 73822786 missense probably damaging 0.98
R6530:Nkd2 UTSW 13 73822690 missense probably null 1.00
R7475:Nkd2 UTSW 13 73825742 missense probably damaging 1.00
R7486:Nkd2 UTSW 13 73847442 splice site probably benign
R7530:Nkd2 UTSW 13 73846959 missense possibly damaging 0.88
R8271:Nkd2 UTSW 13 73821318 missense probably damaging 1.00
R8336:Nkd2 UTSW 13 73821073 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGCCTGCTTGGTAAGGAATCTC -3'
(R):5'- ACATTCTGCTGTGTGAAGCTGGAAG -3'

Sequencing Primer
(F):5'- GAATCTCAGGTAACAGGTCTCTGC -3'
(R):5'- CACAGATCACGCCGAGAAG -3'
Posted On2013-07-11