Incidental Mutation 'R7289:Nr3c1'
ID566290
Institutional Source Beutler Lab
Gene Symbol Nr3c1
Ensembl Gene ENSMUSG00000024431
Gene Namenuclear receptor subfamily 3, group C, member 1
SynonymsGrl-1, GR, Grl1, glucocorticoid receptor
MMRRC Submission
Accession Numbers

Genbank: NM_008173

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7289 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location39410545-39491301 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 39422733 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 517 (I517N)
Ref Sequence ENSEMBL: ENSMUSP00000095199 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025300] [ENSMUST00000097592] [ENSMUST00000115567] [ENSMUST00000115571] [ENSMUST00000152853]
Predicted Effect probably damaging
Transcript: ENSMUST00000025300
AA Change: I516N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000025300
Gene: ENSMUSG00000024431
AA Change: I516N

DomainStartEndE-ValueType
Pfam:GCR 27 418 1.4e-166 PFAM
ZnF_C4 434 505 7.6e-36 SMART
HOLI 580 744 8.8e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000097592
AA Change: I517N

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000095199
Gene: ENSMUSG00000024431
AA Change: I517N

DomainStartEndE-ValueType
Pfam:GCR 27 86 9.2e-16 PFAM
Pfam:GCR 75 418 1.4e-161 PFAM
ZnF_C4 434 506 8.6e-35 SMART
HOLI 581 745 8.8e-32 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115567
AA Change: I516N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000111229
Gene: ENSMUSG00000024431
AA Change: I516N

DomainStartEndE-ValueType
Pfam:GCR 27 418 1.4e-166 PFAM
ZnF_C4 434 505 7.6e-36 SMART
HOLI 580 744 8.8e-32 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115571
AA Change: I516N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000111233
Gene: ENSMUSG00000024431
AA Change: I516N

DomainStartEndE-ValueType
Pfam:GCR 27 418 1.4e-166 PFAM
ZnF_C4 434 505 7.6e-36 SMART
HOLI 580 744 8.8e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152853
SMART Domains Protein: ENSMUSP00000120082
Gene: ENSMUSG00000024431

DomainStartEndE-ValueType
Pfam:GCR 27 418 5.7e-167 PFAM
ZnF_C4 434 488 5.65e-12 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes glucocorticoid receptor, which can function both as a transcription factor that binds to glucocorticoid response elements in the promoters of glucocorticoid responsive genes to activate their transcription, and as a regulator of other transcription factors. This receptor is typically found in the cytoplasm, but upon ligand binding, is transported into the nucleus. It is involved in inflammatory responses, cellular proliferation, and differentiation in target tissues. Mutations in this gene are associated with generalized glucocorticoid resistance. Alternative splicing of this gene results in transcript variants encoding either the same or different isoforms. Additional isoforms resulting from the use of alternate in-frame translation initiation sites have also been described, and shown to be functional, displaying diverse cytoplasm-to-nucleus trafficking patterns and distinct transcriptional activities (PMID:15866175). [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous null mutants die at birth of respiratory failure with underdeveloped lungs, enlarged adrenals, elevated serum corticosterone and ACTH, and failed adrenaline synthesis. Mice with a point mutation have impaired gluconeogenesis and erythropoiesis. [provided by MGI curators]
Allele List at MGI

All alleles(12) : Targeted, knock-out(3) Targeted, other(8) Gene trapped(1)

Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A T 4: 42,972,379 T571S probably benign Het
1700022I11Rik A T 4: 42,973,252 I862F possibly damaging Het
4930563D23Rik T C 16: 92,320,822 I193V probably damaging Het
Aars2 G A 17: 45,507,624 D112N probably damaging Het
Abca7 T A 10: 80,009,944 I1580K probably damaging Het
Aebp1 A G 11: 5,865,059 D234G probably damaging Het
Agap1 T A 1: 89,455,431 M1K probably null Het
Agrn A T 4: 156,178,932 L345H probably damaging Het
Amfr A G 8: 93,999,126 M209T possibly damaging Het
Angel2 G A 1: 190,941,174 R338H possibly damaging Het
Ankrd27 C T 7: 35,631,249 A866V probably damaging Het
Apc G A 18: 34,315,271 R1740Q probably damaging Het
Arhgap32 A T 9: 32,256,937 S739C possibly damaging Het
Arhgap32 G C 9: 32,256,938 S739T probably benign Het
Arhgef2 C T 3: 88,635,885 S418L probably benign Het
Arhgef25 T C 10: 127,183,772 T472A possibly damaging Het
Atrnl1 C T 19: 57,650,414 S328F probably benign Het
Bahcc1 C T 11: 120,280,174 A1514V probably benign Het
Calcoco2 C T 11: 96,099,997 E305K unknown Het
Cdc42bpa A T 1: 180,061,797 K203* probably null Het
Cmc1 A T 9: 118,075,182 I47N possibly damaging Het
Cntln A G 4: 85,046,303 E656G possibly damaging Het
Cyr61 C T 3: 145,648,673 W161* probably null Het
Dcun1d3 T C 7: 119,859,641 K57R possibly damaging Het
Ddx23 T C 15: 98,648,611 E559G probably damaging Het
Dennd6a G A 14: 26,612,038 R367Q probably damaging Het
Desi2 A T 1: 178,256,136 probably benign Het
Dido1 T C 2: 180,659,631 D2160G unknown Het
Epb41 A G 4: 131,991,209 probably null Het
Esrrb T A 12: 86,470,557 probably null Het
Fabp1 C A 6: 71,203,127 T94N probably benign Het
Fam120a A T 13: 48,892,006 C785S probably damaging Het
Foxc1 A G 13: 31,807,260 Y18C probably damaging Het
Fshr T C 17: 88,985,844 T469A probably benign Het
Gm11639 T C 11: 105,038,358 M4838T probably benign Het
Gm14399 T A 2: 175,130,411 H517L unknown Het
Gm39115 G T 7: 142,135,560 Q159K unknown Het
Gm7347 T A 5: 26,057,308 I72F possibly damaging Het
Gm9573 G A 17: 35,618,869 A1475V unknown Het
Hmcn1 A G 1: 150,683,715 V2395A possibly damaging Het
Ighv5-17 T G 12: 113,859,238 T88P probably damaging Het
Insm2 T A 12: 55,600,544 Y358N probably damaging Het
Kazn A T 4: 142,117,175 L409Q Het
Kcnj5 A C 9: 32,322,749 L90R probably damaging Het
Kcnv2 A T 19: 27,333,684 T484S probably damaging Het
Kdm3b T C 18: 34,794,504 Y140H probably benign Het
Kif1bp A C 10: 62,566,116 C261W probably damaging Het
Krt25 C T 11: 99,321,272 A180T probably benign Het
Mmp1a A G 9: 7,467,293 E290G probably damaging Het
Nxpe2 A G 9: 48,323,039 probably null Het
Oaz1 C A 10: 80,826,839 T27K possibly damaging Het
Olfr1053 A G 2: 86,315,025 M87T probably benign Het
Olfr1093 G T 2: 86,786,690 C320F probably benign Het
Olfr1178 A T 2: 88,391,706 H153L probably damaging Het
Olfr1336 T A 7: 6,460,778 W90R probably benign Het
Olfr284 A G 15: 98,340,062 V309A probably damaging Het
Olfr561 T C 7: 102,775,427 I301T probably damaging Het
Pafah2 A T 4: 134,419,997 K319M probably damaging Het
Pask A T 1: 93,331,587 V236E probably damaging Het
Pcdh1 T C 18: 38,189,913 T956A probably damaging Het
Pcdhb18 C A 18: 37,490,647 N343K probably damaging Het
Pcsk2 A T 2: 143,690,423 I164F probably damaging Het
Phf1 T C 17: 26,935,315 Y169H probably damaging Het
Pkdrej T A 15: 85,821,100 I212F probably benign Het
Pnkp T A 7: 44,858,690 W146R probably damaging Het
Prkcb A T 7: 122,544,687 I325F probably benign Het
Ptpn21 C T 12: 98,704,191 D239N probably benign Het
Ptprb A G 10: 116,328,165 T626A probably damaging Het
Pttg1 T C 11: 43,421,089 N180D probably benign Het
Raly G A 2: 154,861,854 R115Q probably damaging Het
Rims2 A T 15: 39,437,718 M474L probably benign Het
Sash1 A T 10: 8,730,196 I810N probably damaging Het
Scnn1g T A 7: 121,738,081 L55* probably null Het
Sema6b A T 17: 56,125,573 D543E possibly damaging Het
Serpina11 C T 12: 103,986,502 G5E unknown Het
Sesn3 A T 9: 14,276,552 M1L probably benign Het
Sez6 T A 11: 77,974,323 I632N possibly damaging Het
Sgo2b A T 8: 63,941,158 I49N probably damaging Het
Slc30a2 A T 4: 134,344,213 I86F possibly damaging Het
Slc38a6 T A 12: 73,287,012 W30R probably benign Het
Stk31 T G 6: 49,438,459 V576G probably benign Het
Szt2 G A 4: 118,375,878 T2297I unknown Het
Tmem208 T C 8: 105,334,786 F148S possibly damaging Het
Tprgl A G 4: 154,160,574 L19P possibly damaging Het
Tubg2 C A 11: 101,160,071 N207K probably damaging Het
Ube2n G T 10: 95,541,750 K130N probably benign Het
Usp36 T C 11: 118,273,529 Y384C probably damaging Het
Vcan A T 13: 89,692,733 L1564* probably null Het
Xkr6 A T 14: 63,798,299 D283V unknown Het
Zfp654 T C 16: 64,785,160 H352R probably benign Het
Zfp819 T A 7: 43,617,082 C330S probably damaging Het
Zfp970 G T 2: 177,475,293 C220F probably damaging Het
Other mutations in Nr3c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Nr3c1 APN 18 39428608 splice site probably null
IGL00798:Nr3c1 APN 18 39486871 missense probably damaging 1.00
IGL01527:Nr3c1 APN 18 39486637 missense probably benign 0.00
IGL02088:Nr3c1 APN 18 39424391 missense probably damaging 1.00
IGL02244:Nr3c1 APN 18 39421557 unclassified probably benign
IGL03145:Nr3c1 APN 18 39486260 missense probably damaging 1.00
IGL03236:Nr3c1 APN 18 39486391 missense probably benign 0.00
3-1:Nr3c1 UTSW 18 39486039 missense probably benign
R1296:Nr3c1 UTSW 18 39486998 nonsense probably null
R2251:Nr3c1 UTSW 18 39486751 missense probably benign 0.38
R2253:Nr3c1 UTSW 18 39486751 missense probably benign 0.38
R2922:Nr3c1 UTSW 18 39487103 missense possibly damaging 0.93
R4667:Nr3c1 UTSW 18 39428727 missense probably benign 0.22
R4971:Nr3c1 UTSW 18 39486877 missense probably damaging 1.00
R5106:Nr3c1 UTSW 18 39486601 missense possibly damaging 0.80
R5732:Nr3c1 UTSW 18 39415699 missense probably damaging 1.00
R5939:Nr3c1 UTSW 18 39420653 missense probably benign 0.26
R5976:Nr3c1 UTSW 18 39421549 missense probably damaging 1.00
R6091:Nr3c1 UTSW 18 39486958 small deletion probably benign
R6666:Nr3c1 UTSW 18 39487147 missense probably damaging 1.00
R7073:Nr3c1 UTSW 18 39486396 missense probably benign 0.00
R7286:Nr3c1 UTSW 18 39486460 small insertion probably benign
R7289:Nr3c1 UTSW 18 39414601 missense probably benign 0.37
R7334:Nr3c1 UTSW 18 39487037 missense probably benign 0.00
X0019:Nr3c1 UTSW 18 39487142 missense probably damaging 0.96
X0062:Nr3c1 UTSW 18 39428792 splice site probably null
Predicted Primers PCR Primer
(F):5'- CTCCATGCTGAGTCTGGAAC -3'
(R):5'- GCCTTGAGTCATGCACAGATG -3'

Sequencing Primer
(F):5'- TGGAACAGAGCTGTCATATCCTGC -3'
(R):5'- GCATATGCACGTGTACATACAC -3'
Posted On2019-06-26