Mutagenetix > Incidental Mutation

Incidental Mutation 'R7289:Atrnl1'

566292

Institutional Source

Beutler Lab

Gene Symbol

Atrnl1

Ensembl Gene

ENSMUSG00000054843

Gene Name

attractin like 1

Synonyms

Alp

MMRRC Submission

045396-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.190) question?

Stock #

R7289 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

57611034-58133338 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 57650414 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Phenylalanine at position 328 (S328F)

Ref Sequence

ENSEMBL: ENSMUSP00000076514 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077282]

AlphaFold

Q6A051

Predicted Effect

probably benign
Transcript: ENSMUST00000077282
AA Change: S328F

PolyPhen 2 Score 0.130 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000076514
Gene: ENSMUSG00000054843
AA Change: S328F

Domain	Start	End	E-Value	Type
low complexity region	25	32	N/A	INTRINSIC
EGF	61	90	5.71e-1	SMART
CUB	92	208	1.43e-11	SMART
EGF	209	244	1.95e1	SMART
Pfam:EGF_2	248	279	5.8e-7	PFAM
Pfam:Kelch_5	350	391	2.1e-9	PFAM
Pfam:Kelch_6	354	401	5.8e-8	PFAM
Pfam:Kelch_4	465	517	4.3e-7	PFAM
Pfam:Kelch_1	519	573	2.7e-6	PFAM
PSI	613	656	3.38e-1	SMART
PSI	665	708	2e-3	SMART
PSI	714	759	1.72e-2	SMART
CLECT	747	872	2.86e-20	SMART
PSI	888	938	6.26e-5	SMART
PSI	941	1011	1.73e-7	SMART
EGF_Lam	1013	1056	1.07e-5	SMART
low complexity region	1157	1173	N/A	INTRINSIC
transmembrane domain	1229	1251	N/A	INTRINSIC
low complexity region	1261	1272	N/A	INTRINSIC
low complexity region	1326	1339	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele exhibit normal coat coloring and normal brain morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700022I11Rik	A	T	4: 42,972,379	T571S	probably benign	Het
1700022I11Rik	A	T	4: 42,973,252	I862F	possibly damaging	Het
4930563D23Rik	T	C	16: 92,320,822	I193V	probably damaging	Het
Aars2	G	A	17: 45,507,624	D112N	probably damaging	Het
Abca7	T	A	10: 80,009,944	I1580K	probably damaging	Het
Aebp1	A	G	11: 5,865,059	D234G	probably damaging	Het
Agap1	T	A	1: 89,455,431	M1K	probably null	Het
Agrn	A	T	4: 156,178,932	L345H	probably damaging	Het
Amfr	A	G	8: 93,999,126	M209T	possibly damaging	Het
Angel2	G	A	1: 190,941,174	R338H	possibly damaging	Het
Ankrd27	C	T	7: 35,631,249	A866V	probably damaging	Het
Apc	G	A	18: 34,315,271	R1740Q	probably damaging	Het
Arhgap32	A	T	9: 32,256,937	S739C	possibly damaging	Het
Arhgap32	G	C	9: 32,256,938	S739T	probably benign	Het
Arhgef2	C	T	3: 88,635,885	S418L	probably benign	Het
Arhgef25	T	C	10: 127,183,772	T472A	possibly damaging	Het
Bahcc1	C	T	11: 120,280,174	A1514V	probably benign	Het
Calcoco2	C	T	11: 96,099,997	E305K	unknown	Het
Cdc42bpa	A	T	1: 180,061,797	K203*	probably null	Het
Cmc1	A	T	9: 118,075,182	I47N	possibly damaging	Het
Cntln	A	G	4: 85,046,303	E656G	possibly damaging	Het
Cyr61	C	T	3: 145,648,673	W161*	probably null	Het
Dcun1d3	T	C	7: 119,859,641	K57R	possibly damaging	Het
Ddx23	T	C	15: 98,648,611	E559G	probably damaging	Het
Dennd6a	G	A	14: 26,612,038	R367Q	probably damaging	Het
Desi2	A	T	1: 178,256,136		probably benign	Het
Dido1	T	C	2: 180,659,631	D2160G	unknown	Het
Epb41	A	G	4: 131,991,209		probably null	Het
Esrrb	T	A	12: 86,470,557		probably null	Het
Fabp1	C	A	6: 71,203,127	T94N	probably benign	Het
Fam120a	A	T	13: 48,892,006	C785S	probably damaging	Het
Foxc1	A	G	13: 31,807,260	Y18C	probably damaging	Het
Fshr	T	C	17: 88,985,844	T469A	probably benign	Het
Gm11639	T	C	11: 105,038,358	M4838T	probably benign	Het
Gm14399	T	A	2: 175,130,411	H517L	unknown	Het
Gm39115	G	T	7: 142,135,560	Q159K	unknown	Het
Gm7347	T	A	5: 26,057,308	I72F	possibly damaging	Het
Gm9573	G	A	17: 35,618,869	A1475V	unknown	Het
Hmcn1	A	G	1: 150,683,715	V2395A	possibly damaging	Het
Ighv5-17	T	G	12: 113,859,238	T88P	probably damaging	Het
Insm2	T	A	12: 55,600,544	Y358N	probably damaging	Het
Kazn	A	T	4: 142,117,175	L409Q		Het
Kcnj5	A	C	9: 32,322,749	L90R	probably damaging	Het
Kcnv2	A	T	19: 27,333,684	T484S	probably damaging	Het
Kdm3b	T	C	18: 34,794,504	Y140H	probably benign	Het
Kif1bp	A	C	10: 62,566,116	C261W	probably damaging	Het
Krt25	C	T	11: 99,321,272	A180T	probably benign	Het
Mmp1a	A	G	9: 7,467,293	E290G	probably damaging	Het
Nr3c1	T	C	18: 39,414,601	T755A	probably benign	Het
Nr3c1	A	T	18: 39,422,733	I517N	probably benign	Het
Nxpe2	A	G	9: 48,323,039		probably null	Het
Oaz1	C	A	10: 80,826,839	T27K	possibly damaging	Het
Olfr1053	A	G	2: 86,315,025	M87T	probably benign	Het
Olfr1093	G	T	2: 86,786,690	C320F	probably benign	Het
Olfr1178	A	T	2: 88,391,706	H153L	probably damaging	Het
Olfr1336	T	A	7: 6,460,778	W90R	probably benign	Het
Olfr284	A	G	15: 98,340,062	V309A	probably damaging	Het
Olfr561	T	C	7: 102,775,427	I301T	probably damaging	Het
Pafah2	A	T	4: 134,419,997	K319M	probably damaging	Het
Pask	A	T	1: 93,331,587	V236E	probably damaging	Het
Pcdh1	T	C	18: 38,189,913	T956A	probably damaging	Het
Pcdhb18	C	A	18: 37,490,647	N343K	probably damaging	Het
Pcsk2	A	T	2: 143,690,423	I164F	probably damaging	Het
Phf1	T	C	17: 26,935,315	Y169H	probably damaging	Het
Pkdrej	T	A	15: 85,821,100	I212F	probably benign	Het
Pnkp	T	A	7: 44,858,690	W146R	probably damaging	Het
Prkcb	A	T	7: 122,544,687	I325F	probably benign	Het
Ptpn21	C	T	12: 98,704,191	D239N	probably benign	Het
Ptprb	A	G	10: 116,328,165	T626A	probably damaging	Het
Pttg1	T	C	11: 43,421,089	N180D	probably benign	Het
Raly	G	A	2: 154,861,854	R115Q	probably damaging	Het
Rims2	A	T	15: 39,437,718	M474L	probably benign	Het
Sash1	A	T	10: 8,730,196	I810N	probably damaging	Het
Scnn1g	T	A	7: 121,738,081	L55*	probably null	Het
Sema6b	A	T	17: 56,125,573	D543E	possibly damaging	Het
Serpina11	C	T	12: 103,986,502	G5E	unknown	Het
Sesn3	A	T	9: 14,276,552	M1L	probably benign	Het
Sez6	T	A	11: 77,974,323	I632N	possibly damaging	Het
Sgo2b	A	T	8: 63,941,158	I49N	probably damaging	Het
Slc30a2	A	T	4: 134,344,213	I86F	possibly damaging	Het
Slc38a6	T	A	12: 73,287,012	W30R	probably benign	Het
Stk31	T	G	6: 49,438,459	V576G	probably benign	Het
Szt2	G	A	4: 118,375,878	T2297I	unknown	Het
Tmem208	T	C	8: 105,334,786	F148S	possibly damaging	Het
Tprgl	A	G	4: 154,160,574	L19P	possibly damaging	Het
Tubg2	C	A	11: 101,160,071	N207K	probably damaging	Het
Ube2n	G	T	10: 95,541,750	K130N	probably benign	Het
Usp36	T	C	11: 118,273,529	Y384C	probably damaging	Het
Vcan	A	T	13: 89,692,733	L1564*	probably null	Het
Xkr6	A	T	14: 63,798,299	D283V	unknown	Het
Zfp654	T	C	16: 64,785,160	H352R	probably benign	Het
Zfp819	T	A	7: 43,617,082	C330S	probably damaging	Het
Zfp970	G	T	2: 177,475,293	C220F	probably damaging	Het

Other mutations in Atrnl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00323:Atrnl1	APN	19	57691817	missense	probably benign	0.02
IGL00707:Atrnl1	APN	19	57673265	missense	probably damaging	0.96
IGL00921:Atrnl1	APN	19	57702153	missense	probably damaging	1.00
IGL01410:Atrnl1	APN	19	58131104	missense	probably damaging	1.00
IGL01468:Atrnl1	APN	19	57699712	missense	probably benign	0.02
IGL01756:Atrnl1	APN	19	57652948	missense	probably benign
IGL01971:Atrnl1	APN	19	57753283	missense	probably damaging	1.00
IGL02019:Atrnl1	APN	19	57691763	splice site	probably benign
IGL02580:Atrnl1	APN	19	57714576	splice site	probably benign
IGL02649:Atrnl1	APN	19	57650441	splice site	probably benign
IGL02676:Atrnl1	APN	19	57691884	missense	probably damaging	1.00
IGL03276:Atrnl1	APN	19	57652927	missense	probably damaging	0.99
IGL03379:Atrnl1	APN	19	57642541	missense	probably benign	0.02
Magnetogorsk	UTSW	19	57630306	missense	probably damaging	1.00
polar	UTSW	19	57652950	missense	probably benign	0.00
PIT4812001:Atrnl1	UTSW	19	57731623	missense	probably benign	0.08
R0109:Atrnl1	UTSW	19	57755517	missense	possibly damaging	0.78
R0308:Atrnl1	UTSW	19	57753288	missense	probably benign	0.04
R0394:Atrnl1	UTSW	19	57673176	missense	probably benign	0.10
R0734:Atrnl1	UTSW	19	57654861	missense	probably damaging	1.00
R0811:Atrnl1	UTSW	19	57673141	missense	probably benign	0.07
R0812:Atrnl1	UTSW	19	57673141	missense	probably benign	0.07
R1183:Atrnl1	UTSW	19	57650293	missense	probably damaging	0.97
R1213:Atrnl1	UTSW	19	57638462	missense	probably benign	0.25
R1344:Atrnl1	UTSW	19	57935705	critical splice donor site	probably null
R1418:Atrnl1	UTSW	19	57935705	critical splice donor site	probably null
R1707:Atrnl1	UTSW	19	57686737	missense	probably benign	0.00
R1748:Atrnl1	UTSW	19	57714702	missense	probably damaging	0.99
R2051:Atrnl1	UTSW	19	57691849	missense	probably benign	0.01
R2113:Atrnl1	UTSW	19	57755616	nonsense	probably null
R2130:Atrnl1	UTSW	19	57654994	missense	probably damaging	1.00
R3710:Atrnl1	UTSW	19	57657114	missense	probably damaging	1.00
R3916:Atrnl1	UTSW	19	57935652	missense	possibly damaging	0.82
R4524:Atrnl1	UTSW	19	57630306	missense	probably damaging	1.00
R4707:Atrnl1	UTSW	19	57629158	missense	probably damaging	0.97
R4712:Atrnl1	UTSW	19	57652950	missense	probably benign	0.00
R4784:Atrnl1	UTSW	19	57629158	missense	probably damaging	0.97
R4785:Atrnl1	UTSW	19	57629158	missense	probably damaging	0.97
R4798:Atrnl1	UTSW	19	58042361	missense	probably benign
R5172:Atrnl1	UTSW	19	57685513	nonsense	probably null
R5226:Atrnl1	UTSW	19	57650335	missense	probably benign
R5289:Atrnl1	UTSW	19	57657082	missense	probably damaging	1.00
R5372:Atrnl1	UTSW	19	57755536	missense	probably benign
R5737:Atrnl1	UTSW	19	57777888	missense	possibly damaging	0.84
R5782:Atrnl1	UTSW	19	57753286	missense	possibly damaging	0.95
R5826:Atrnl1	UTSW	19	57630292	nonsense	probably null
R6169:Atrnl1	UTSW	19	57642463	missense	probably benign	0.00
R6242:Atrnl1	UTSW	19	57642478	missense	probably benign	0.02
R6342:Atrnl1	UTSW	19	57638510	missense	probably damaging	1.00
R6372:Atrnl1	UTSW	19	57650332	missense	probably benign	0.01
R6811:Atrnl1	UTSW	19	57654961	missense	probably damaging	0.98
R6897:Atrnl1	UTSW	19	58042368	missense	probably benign	0.01
R7024:Atrnl1	UTSW	19	57638450	critical splice acceptor site	probably null
R7085:Atrnl1	UTSW	19	57691857	missense	probably damaging	1.00
R7144:Atrnl1	UTSW	19	58042352	missense	probably damaging	1.00
R7259:Atrnl1	UTSW	19	57935606	nonsense	probably null
R7310:Atrnl1	UTSW	19	57642424	missense	possibly damaging	0.69
R7372:Atrnl1	UTSW	19	57935646	missense	possibly damaging	0.47
R7432:Atrnl1	UTSW	19	57755524	missense	probably damaging	1.00
R7478:Atrnl1	UTSW	19	57696312	missense	possibly damaging	0.89
R7556:Atrnl1	UTSW	19	57654846	missense	probably benign
R7567:Atrnl1	UTSW	19	57699523	missense	probably damaging	0.98
R7608:Atrnl1	UTSW	19	57714687	missense	probably damaging	1.00
R7632:Atrnl1	UTSW	19	57630306	missense	probably damaging	1.00
R7655:Atrnl1	UTSW	19	57611379	nonsense	probably null
R7656:Atrnl1	UTSW	19	57611379	nonsense	probably null
R7718:Atrnl1	UTSW	19	57740183	nonsense	probably null
R7721:Atrnl1	UTSW	19	57696331	missense	probably benign	0.00
R7726:Atrnl1	UTSW	19	57702072	missense	probably damaging	1.00
R7733:Atrnl1	UTSW	19	57701988	missense	probably benign	0.00
R7774:Atrnl1	UTSW	19	57699671	missense	probably damaging	1.00
R8010:Atrnl1	UTSW	19	57682446	missense	probably benign	0.14
R8119:Atrnl1	UTSW	19	57642463	missense	probably benign	0.00
R9242:Atrnl1	UTSW	19	57657228	missense	probably benign	0.07
R9265:Atrnl1	UTSW	19	57777927	missense	probably benign	0.11
R9272:Atrnl1	UTSW	19	57654988	missense	probably benign	0.00
R9480:Atrnl1	UTSW	19	57701988	missense	possibly damaging	0.61
R9526:Atrnl1	UTSW	19	57629119	missense	probably damaging	0.99
R9672:Atrnl1	UTSW	19	57630263	missense	possibly damaging	0.87
R9673:Atrnl1	UTSW	19	57611354	start codon destroyed	probably null	0.04
RF021:Atrnl1	UTSW	19	57642473	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GTGATCTGCTTCGGTAATGTAAGATC -3'
(R):5'- ACAGCTATGCATACATAATTGCATG -3'

Sequencing Primer
(F):5'- CTTTGTTTAATTCAATGTGTTGCTTG -3'
(R):5'- CATTGACTGCCTATGGTC -3'

Posted On

2019-06-26