Incidental Mutation 'R7290:Ptpn18'
ID 566293
Institutional Source Beutler Lab
Gene Symbol Ptpn18
Ensembl Gene ENSMUSG00000026126
Gene Name protein tyrosine phosphatase, non-receptor type 18
Synonyms Ptpk1, PTP-HSCF, FLP1, HSCF, PTP-K1
MMRRC Submission 045362-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.156) question?
Stock # R7290 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 34498843-34514814 bp(+) (GRCm39)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 34501892 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000027302 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027302] [ENSMUST00000190122]
AlphaFold Q61152
Predicted Effect probably null
Transcript: ENSMUST00000027302
SMART Domains Protein: ENSMUSP00000027302
Gene: ENSMUSG00000026126

DomainStartEndE-ValueType
PTPc 25 293 7.77e-115 SMART
Predicted Effect probably null
Transcript: ENSMUST00000190122
SMART Domains Protein: ENSMUSP00000139885
Gene: ENSMUSG00000026126

DomainStartEndE-ValueType
PTPc 2 269 9.1e-113 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, the mitotic cycle, and oncogenic transformation. This PTP contains a PEST motif, which often serves as a protein-protein interaction domain, and may be related to protein intracellular half-live. This protein can differentially dephosphorylate autophosphorylated tyrosine kinases that are overexpressed in tumor tissues, and it appears to regulate HER2, a member of the epidermal growth factor receptor family of receptor tyrosine kinases. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2008]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a T A 11: 109,921,714 (GRCm39) M1447L probably benign Het
Adam30 G A 3: 98,070,257 (GRCm39) V697I probably benign Het
Adamts12 A G 15: 11,277,452 (GRCm39) N689D probably benign Het
Adamts15 T C 9: 30,813,906 (GRCm39) K753R probably benign Het
Adra2a T C 19: 54,034,835 (GRCm39) F64L probably damaging Het
Ankub1 A G 3: 57,580,345 (GRCm39) L104P probably damaging Het
Arel1 A G 12: 84,988,719 (GRCm39) V10A probably benign Het
Atad2 A T 15: 57,962,047 (GRCm39) N1165K probably benign Het
Atp6v0d2 T A 4: 19,880,060 (GRCm39) D279V probably benign Het
Cadps A T 14: 12,616,099 (GRCm38) D310E probably damaging Het
Caskin2 T C 11: 115,695,615 (GRCm39) I249V possibly damaging Het
Cdh23 T C 10: 60,212,620 (GRCm39) N1598S probably benign Het
Cep250 A T 2: 155,834,682 (GRCm39) Q2202H probably benign Het
Ces5a T A 8: 94,261,311 (GRCm39) T35S probably damaging Het
Cnot11 G A 1: 39,579,020 (GRCm39) W295* probably null Het
Cntnap5a G T 1: 116,149,619 (GRCm39) W565L probably damaging Het
Dgka T C 10: 128,569,468 (GRCm39) E148G probably damaging Het
Dnah14 G A 1: 181,455,739 (GRCm39) D955N probably benign Het
Erbin G A 13: 103,998,834 (GRCm39) T184I probably damaging Het
Fam20c G T 5: 138,793,309 (GRCm39) G477W probably damaging Het
Fan1 T A 7: 64,022,234 (GRCm39) N340Y probably damaging Het
Fgfr4 T C 13: 55,309,262 (GRCm39) V433A probably benign Het
Gal3st1 A T 11: 3,948,093 (GRCm39) Q100L possibly damaging Het
Gfra2 T C 14: 71,163,380 (GRCm39) F221S probably damaging Het
Gm19965 G A 1: 116,748,921 (GRCm39) V201M Het
Gnb1l A T 16: 18,382,806 (GRCm39) T282S probably benign Het
Gpr171 A T 3: 59,005,147 (GRCm39) N209K probably benign Het
Greb1 G A 12: 16,761,739 (GRCm39) T547I probably damaging Het
Ifi214 A T 1: 173,357,097 (GRCm39) V2E probably benign Het
Ighv1-71 T C 12: 115,706,267 (GRCm39) M1V probably null Het
Itm2b C T 14: 73,605,785 (GRCm39) G67D probably damaging Het
Kif21a A T 15: 90,851,432 (GRCm39) C995* probably null Het
Kifc2 A T 15: 76,544,904 (GRCm39) Y13F probably damaging Het
Lamb1 T A 12: 31,315,595 (GRCm39) V59D probably benign Het
Lhx1 A T 11: 84,412,703 (GRCm39) D163E probably damaging Het
Lrrc1 A T 9: 77,365,121 (GRCm39) Y187N probably benign Het
Map3k1 C A 13: 111,904,645 (GRCm39) V380F probably damaging Het
Mapk11 T C 15: 89,028,511 (GRCm39) D283G probably damaging Het
Mccc2 G T 13: 100,091,207 (GRCm39) A430D probably damaging Het
Mest A G 6: 30,747,158 (GRCm39) N340S unknown Het
Mms22l T C 4: 24,517,139 (GRCm39) L340P probably benign Het
Mrnip A G 11: 50,087,808 (GRCm39) Y110C possibly damaging Het
Mtmr4 A G 11: 87,502,063 (GRCm39) T706A probably benign Het
Muc21 G A 17: 35,929,761 (GRCm39) A1475V unknown Het
Ncstn A G 1: 171,900,373 (GRCm39) F234S probably benign Het
Nrp1 T C 8: 129,202,777 (GRCm39) probably null Het
Nup37 T G 10: 88,010,356 (GRCm39) C217G probably damaging Het
Or8g22 A G 9: 38,958,694 (GRCm39) L7P unknown Het
Pdzrn3 T C 6: 101,128,206 (GRCm39) N820S probably benign Het
Pgap1 A T 1: 54,587,225 (GRCm39) F117Y possibly damaging Het
Phip A T 9: 82,753,346 (GRCm39) F1799L possibly damaging Het
Ppm1f T A 16: 16,728,819 (GRCm39) F74I probably benign Het
Prpf8 C A 11: 75,384,783 (GRCm39) N775K possibly damaging Het
Ptdss2 T C 7: 140,731,693 (GRCm39) I167T possibly damaging Het
Rbl2 C A 8: 91,841,669 (GRCm39) A955D probably benign Het
Rgl1 A G 1: 152,420,146 (GRCm39) S366P possibly damaging Het
Rit2 A T 18: 31,376,221 (GRCm39) M38K possibly damaging Het
Robo1 A G 16: 72,801,408 (GRCm39) M1011V probably benign Het
Senp6 A T 9: 80,043,797 (GRCm39) E809D probably benign Het
Stard3 G A 11: 98,269,045 (GRCm39) probably null Het
Taar3 T G 10: 23,826,298 (GRCm39) Y281* probably null Het
Tacc2 G T 7: 130,331,103 (GRCm39) K352N probably benign Het
Tamalin G A 15: 101,129,419 (GRCm39) S234N probably damaging Het
Tasor T A 14: 27,160,610 (GRCm39) I124N probably damaging Het
Tdpoz4 G A 3: 93,704,155 (GRCm39) V151I not run Het
Tenm2 A G 11: 35,914,298 (GRCm39) L2413P probably damaging Het
Tgm6 T C 2: 129,983,110 (GRCm39) V233A probably damaging Het
Tlx3 G A 11: 33,153,514 (GRCm39) probably benign Het
Tmem94 G T 11: 115,677,082 (GRCm39) R118L possibly damaging Het
Trim23 C A 13: 104,323,941 (GRCm39) H133Q probably damaging Het
Unc80 A T 1: 66,640,356 (GRCm39) D1421V probably damaging Het
Vmn1r172 A G 7: 23,360,048 (GRCm39) N311S unknown Het
Vps25 T A 11: 101,149,775 (GRCm39) L153Q probably damaging Het
Wbp1l G T 19: 46,611,876 (GRCm39) probably benign Het
Ythdc2 A G 18: 44,970,558 (GRCm39) I291V possibly damaging Het
Zfp2 A G 11: 50,791,570 (GRCm39) C158R probably damaging Het
Zfp786 G A 6: 47,796,929 (GRCm39) P670S probably damaging Het
Zfp827 G A 8: 79,916,442 (GRCm39) R339H possibly damaging Het
Zmym6 C T 4: 127,017,294 (GRCm39) A1025V possibly damaging Het
Other mutations in Ptpn18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00488:Ptpn18 APN 1 34,502,200 (GRCm39) missense probably damaging 0.98
IGL01611:Ptpn18 APN 1 34,498,898 (GRCm39) utr 5 prime probably benign
IGL01633:Ptpn18 APN 1 34,510,989 (GRCm39) missense probably benign 0.03
IGL03379:Ptpn18 APN 1 34,509,338 (GRCm39) splice site probably null
R0848:Ptpn18 UTSW 1 34,501,783 (GRCm39) missense probably damaging 1.00
R1400:Ptpn18 UTSW 1 34,502,587 (GRCm39) critical splice donor site probably null
R1973:Ptpn18 UTSW 1 34,502,190 (GRCm39) missense probably damaging 1.00
R2040:Ptpn18 UTSW 1 34,509,300 (GRCm39) missense probably damaging 0.99
R2113:Ptpn18 UTSW 1 34,510,742 (GRCm39) missense probably damaging 1.00
R2963:Ptpn18 UTSW 1 34,510,773 (GRCm39) nonsense probably null
R4061:Ptpn18 UTSW 1 34,512,011 (GRCm39) missense possibly damaging 0.66
R4062:Ptpn18 UTSW 1 34,512,011 (GRCm39) missense possibly damaging 0.66
R4509:Ptpn18 UTSW 1 34,501,823 (GRCm39) missense possibly damaging 0.49
R4522:Ptpn18 UTSW 1 34,512,041 (GRCm39) missense probably benign
R4626:Ptpn18 UTSW 1 34,510,873 (GRCm39) splice site probably null
R4978:Ptpn18 UTSW 1 34,508,894 (GRCm39) intron probably benign
R5260:Ptpn18 UTSW 1 34,502,591 (GRCm39) splice site probably benign
R5335:Ptpn18 UTSW 1 34,502,259 (GRCm39) missense probably damaging 1.00
R5481:Ptpn18 UTSW 1 34,510,744 (GRCm39) missense possibly damaging 0.67
R5865:Ptpn18 UTSW 1 34,510,644 (GRCm39) splice site probably benign
R7038:Ptpn18 UTSW 1 34,498,906 (GRCm39) start codon destroyed probably null 1.00
R7225:Ptpn18 UTSW 1 34,511,927 (GRCm39) missense possibly damaging 0.58
R7411:Ptpn18 UTSW 1 34,511,273 (GRCm39) critical splice donor site probably null
R7434:Ptpn18 UTSW 1 34,512,445 (GRCm39) missense possibly damaging 0.75
R7441:Ptpn18 UTSW 1 34,512,416 (GRCm39) missense probably benign 0.00
R7442:Ptpn18 UTSW 1 34,501,831 (GRCm39) missense probably benign 0.02
R7462:Ptpn18 UTSW 1 34,512,445 (GRCm39) missense possibly damaging 0.75
R7463:Ptpn18 UTSW 1 34,512,445 (GRCm39) missense possibly damaging 0.75
R7464:Ptpn18 UTSW 1 34,512,445 (GRCm39) missense possibly damaging 0.75
R7465:Ptpn18 UTSW 1 34,512,445 (GRCm39) missense possibly damaging 0.75
R7535:Ptpn18 UTSW 1 34,512,445 (GRCm39) missense possibly damaging 0.75
R7537:Ptpn18 UTSW 1 34,512,445 (GRCm39) missense possibly damaging 0.75
R7678:Ptpn18 UTSW 1 34,512,445 (GRCm39) missense possibly damaging 0.75
R7689:Ptpn18 UTSW 1 34,512,445 (GRCm39) missense possibly damaging 0.75
R7899:Ptpn18 UTSW 1 34,508,986 (GRCm39) splice site probably null
R8543:Ptpn18 UTSW 1 34,511,229 (GRCm39) missense probably benign 0.00
R8821:Ptpn18 UTSW 1 34,511,271 (GRCm39) missense probably null 1.00
R8831:Ptpn18 UTSW 1 34,511,271 (GRCm39) missense probably null 1.00
R8858:Ptpn18 UTSW 1 34,502,196 (GRCm39) missense possibly damaging 0.88
R8879:Ptpn18 UTSW 1 34,502,211 (GRCm39) missense probably benign 0.23
R8924:Ptpn18 UTSW 1 34,498,966 (GRCm39) missense probably benign 0.02
R9657:Ptpn18 UTSW 1 34,512,473 (GRCm39) missense possibly damaging 0.87
X0065:Ptpn18 UTSW 1 34,508,972 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGCACTGGGCCTGACTTTC -3'
(R):5'- GCTTCAGGGAGTAATGCAGC -3'

Sequencing Primer
(F):5'- GGGCCTGACTTTCACCTG -3'
(R):5'- TTCAGGGAGTAATGCAGCTACCTC -3'
Posted On 2019-06-26