Incidental Mutation 'R7290:Zfp827'
ID566320
Institutional Source Beutler Lab
Gene Symbol Zfp827
Ensembl Gene ENSMUSG00000071064
Gene Namezinc finger protein 827
Synonyms2810449M09Rik, D630040G17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.725) question?
Stock #R7290 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location79028437-79193766 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 79189813 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 339 (R339H)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098614] [ENSMUST00000119254] [ENSMUST00000148713]
Predicted Effect probably benign
Transcript: ENSMUST00000098614
SMART Domains Protein: ENSMUSP00000096214
Gene: ENSMUSG00000071064

DomainStartEndE-ValueType
low complexity region 102 128 N/A INTRINSIC
low complexity region 226 256 N/A INTRINSIC
low complexity region 271 298 N/A INTRINSIC
low complexity region 306 342 N/A INTRINSIC
low complexity region 343 348 N/A INTRINSIC
ZnF_C2H2 371 393 6.78e-3 SMART
ZnF_C2H2 399 421 2.99e-4 SMART
ZnF_C2H2 430 452 5.42e-2 SMART
internal_repeat_2 561 585 3.31e-7 PROSPERO
low complexity region 613 627 N/A INTRINSIC
internal_repeat_2 719 743 3.31e-7 PROSPERO
ZnF_C2H2 814 836 2.4e-3 SMART
ZnF_C2H2 842 864 4.72e-2 SMART
ZnF_C2H2 894 916 1.64e-1 SMART
ZnF_C2H2 926 949 7.89e0 SMART
low complexity region 956 974 N/A INTRINSIC
ZnF_C2H2 1016 1038 1.26e-2 SMART
ZnF_C2H2 1044 1066 3.07e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119254
SMART Domains Protein: ENSMUSP00000113199
Gene: ENSMUSG00000071064

DomainStartEndE-ValueType
low complexity region 102 128 N/A INTRINSIC
low complexity region 226 256 N/A INTRINSIC
low complexity region 271 298 N/A INTRINSIC
low complexity region 306 342 N/A INTRINSIC
low complexity region 343 348 N/A INTRINSIC
ZnF_C2H2 371 393 6.78e-3 SMART
ZnF_C2H2 399 421 2.99e-4 SMART
ZnF_C2H2 430 452 5.42e-2 SMART
internal_repeat_2 561 585 3.25e-7 PROSPERO
low complexity region 613 627 N/A INTRINSIC
internal_repeat_2 719 743 3.25e-7 PROSPERO
ZnF_C2H2 814 836 2.4e-3 SMART
ZnF_C2H2 842 864 4.72e-2 SMART
ZnF_C2H2 894 916 1.64e-1 SMART
ZnF_C2H2 926 949 7.89e0 SMART
low complexity region 956 974 N/A INTRINSIC
ZnF_C2H2 1016 1038 1.26e-2 SMART
ZnF_C2H2 1044 1066 3.07e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129613
SMART Domains Protein: ENSMUSP00000119511
Gene: ENSMUSG00000071064

DomainStartEndE-ValueType
ZnF_C2H2 35 57 1.64e-1 SMART
ZnF_C2H2 67 90 7.89e0 SMART
low complexity region 97 115 N/A INTRINSIC
ZnF_C2H2 157 179 1.26e-2 SMART
ZnF_C2H2 185 207 3.07e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145827
SMART Domains Protein: ENSMUSP00000114208
Gene: ENSMUSG00000071064

DomainStartEndE-ValueType
ZnF_C2H2 77 99 2.4e-3 SMART
ZnF_C2H2 111 133 4.72e-2 SMART
ZnF_C2H2 163 185 1.64e-1 SMART
ZnF_C2H2 195 218 7.89e0 SMART
low complexity region 225 243 N/A INTRINSIC
ZnF_C2H2 285 307 1.26e-2 SMART
ZnF_C2H2 313 335 3.07e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148713
SMART Domains Protein: ENSMUSP00000120913
Gene: ENSMUSG00000071064

DomainStartEndE-ValueType
ZnF_C2H2 106 128 2.4e-3 SMART
ZnF_C2H2 134 156 4.72e-2 SMART
ZnF_C2H2 186 208 1.64e-1 SMART
ZnF_C2H2 218 241 7.89e0 SMART
low complexity region 248 266 N/A INTRINSIC
ZnF_C2H2 308 330 1.26e-2 SMART
ZnF_C2H2 336 358 3.07e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000155960
AA Change: R339H

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000120562
Gene: ENSMUSG00000071064
AA Change: R339H

DomainStartEndE-ValueType
ZnF_C2H2 31 53 2.4e-3 SMART
ZnF_C2H2 59 81 4.72e-2 SMART
ZnF_C2H2 111 133 1.64e-1 SMART
ZnF_C2H2 143 166 7.89e0 SMART
low complexity region 173 191 N/A INTRINSIC
ZnF_C2H2 233 255 1.26e-2 SMART
ZnF_C2H2 261 283 3.07e-1 SMART
ZnF_C2H2 290 312 9.44e-2 SMART
ZnF_C2H2 317 339 4.34e-1 SMART
ZnF_C2H2 345 367 7.9e-4 SMART
ZnF_C2H2 373 396 2.53e-2 SMART
ZnF_C2H2 402 424 2.45e0 SMART
low complexity region 444 466 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a T A 11: 110,030,888 M1447L probably benign Het
Adam30 G A 3: 98,162,941 V697I probably benign Het
Adamts12 A G 15: 11,277,366 N689D probably benign Het
Adamts15 T C 9: 30,902,610 K753R probably benign Het
Adra2a T C 19: 54,046,404 F64L probably damaging Het
Ankub1 A G 3: 57,672,924 L104P probably damaging Het
Arel1 A G 12: 84,941,945 V10A probably benign Het
Atad2 A T 15: 58,098,651 N1165K probably benign Het
Atp6v0d2 T A 4: 19,880,060 D279V probably benign Het
Cadps A T 14: 12,616,099 D310E probably damaging Het
Caskin2 T C 11: 115,804,789 I249V possibly damaging Het
Cdh23 T C 10: 60,376,841 N1598S probably benign Het
Cep250 A T 2: 155,992,762 Q2202H probably benign Het
Ces5a T A 8: 93,534,683 T35S probably damaging Het
Cnot11 G A 1: 39,539,939 W295* probably null Het
Cntnap5a G T 1: 116,221,889 W565L probably damaging Het
Dgka T C 10: 128,733,599 E148G probably damaging Het
Dnah14 G A 1: 181,628,174 D955N probably benign Het
Erbin G A 13: 103,862,326 T184I probably damaging Het
Fam208a T A 14: 27,438,653 I124N probably damaging Het
Fam20c G T 5: 138,807,554 G477W probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fgfr4 T C 13: 55,161,449 V433A probably benign Het
Gal3st1 A T 11: 3,998,093 Q100L possibly damaging Het
Gfra2 T C 14: 70,925,940 F221S probably damaging Het
Gm19965 G A 1: 116,821,191 V201M Het
Gm9573 G A 17: 35,618,869 A1475V unknown Het
Gnb1l A T 16: 18,564,056 T282S probably benign Het
Gpr171 A T 3: 59,097,726 N209K probably benign Het
Grasp G A 15: 101,231,538 S234N probably damaging Het
Greb1 G A 12: 16,711,738 T547I probably damaging Het
Ifi214 A T 1: 173,529,531 V2E probably benign Het
Ighv1-71 T C 12: 115,742,647 M1V probably null Het
Itm2b C T 14: 73,368,345 G67D probably damaging Het
Kif21a A T 15: 90,967,229 C995* probably null Het
Kifc2 A T 15: 76,660,704 Y13F probably damaging Het
Lamb1 T A 12: 31,265,596 V59D probably benign Het
Lhx1 A T 11: 84,521,877 D163E probably damaging Het
Lrrc1 A T 9: 77,457,839 Y187N probably benign Het
Map3k1 C A 13: 111,768,111 V380F probably damaging Het
Mapk11 T C 15: 89,144,308 D283G probably damaging Het
Mccc2 G T 13: 99,954,699 A430D probably damaging Het
Mest A G 6: 30,747,159 N340S unknown Het
Mms22l T C 4: 24,517,139 L340P probably benign Het
Mrnip A G 11: 50,196,981 Y110C possibly damaging Het
Mtmr4 A G 11: 87,611,237 T706A probably benign Het
Ncstn A G 1: 172,072,806 F234S probably benign Het
Nrp1 T C 8: 128,476,296 probably null Het
Nup37 T G 10: 88,174,494 C217G probably damaging Het
Olfr936 A G 9: 39,047,398 L7P unknown Het
Pdzrn3 T C 6: 101,151,245 N820S probably benign Het
Pgap1 A T 1: 54,548,066 F117Y possibly damaging Het
Phip A T 9: 82,871,293 F1799L possibly damaging Het
Ppm1f T A 16: 16,910,955 F74I probably benign Het
Prpf8 C A 11: 75,493,957 N775K possibly damaging Het
Ptdss2 T C 7: 141,151,780 I167T possibly damaging Het
Ptpn18 G A 1: 34,462,811 probably null Het
Rbl2 C A 8: 91,115,041 A955D probably benign Het
Rgl1 A G 1: 152,544,395 S366P possibly damaging Het
Rit2 A T 18: 31,243,168 M38K possibly damaging Het
Robo1 A G 16: 73,004,520 M1011V probably benign Het
Senp6 A T 9: 80,136,515 E809D probably benign Het
Stard3 G A 11: 98,378,219 probably null Het
Taar3 T G 10: 23,950,400 Y281* probably null Het
Tacc2 G T 7: 130,729,373 K352N probably benign Het
Tdpoz4 G A 3: 93,796,848 V151I not run Het
Tenm2 A G 11: 36,023,471 L2413P probably damaging Het
Tgm6 T C 2: 130,141,190 V233A probably damaging Het
Tlx3 G A 11: 33,203,514 probably benign Het
Tmem94 G T 11: 115,786,256 R118L possibly damaging Het
Trim23 C A 13: 104,187,433 H133Q probably damaging Het
Unc80 A T 1: 66,601,197 D1421V probably damaging Het
Vmn1r172 A G 7: 23,660,623 N311S unknown Het
Vps25 T A 11: 101,258,949 L153Q probably damaging Het
Wbp1l G T 19: 46,623,437 probably benign Het
Ythdc2 A G 18: 44,837,491 I291V possibly damaging Het
Zfp2 A G 11: 50,900,743 C158R probably damaging Het
Zfp786 G A 6: 47,819,995 P670S probably damaging Het
Zmym6 C T 4: 127,123,501 A1025V possibly damaging Het
Other mutations in Zfp827
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01448:Zfp827 APN 8 79060733 missense possibly damaging 0.82
IGL01545:Zfp827 APN 8 79070434 missense probably damaging 1.00
IGL01552:Zfp827 APN 8 79076191 missense probably damaging 1.00
IGL02261:Zfp827 APN 8 79180079 missense probably damaging 0.97
IGL02451:Zfp827 APN 8 79060972 missense probably damaging 1.00
IGL03130:Zfp827 APN 8 79060957 missense probably damaging 1.00
IGL03411:Zfp827 APN 8 79076487 missense probably damaging 0.99
E0354:Zfp827 UTSW 8 79136577 missense probably damaging 1.00
R0502:Zfp827 UTSW 8 79179077 splice site probably null
R0547:Zfp827 UTSW 8 79060310 missense probably damaging 1.00
R0926:Zfp827 UTSW 8 79118192 missense probably benign 0.00
R0975:Zfp827 UTSW 8 79061185 missense probably benign 0.00
R1305:Zfp827 UTSW 8 79060894 missense possibly damaging 0.95
R1462:Zfp827 UTSW 8 79076479 missense probably benign
R1462:Zfp827 UTSW 8 79076479 missense probably benign
R1638:Zfp827 UTSW 8 79076346 missense possibly damaging 0.94
R1714:Zfp827 UTSW 8 79060573 missense probably damaging 1.00
R2044:Zfp827 UTSW 8 79076236 missense probably benign
R2132:Zfp827 UTSW 8 79185721 missense possibly damaging 0.53
R3844:Zfp827 UTSW 8 79136619 missense probably damaging 0.99
R4329:Zfp827 UTSW 8 79189834 utr 3 prime probably benign
R4629:Zfp827 UTSW 8 79060382 missense probably damaging 0.99
R4873:Zfp827 UTSW 8 79060774 missense probably damaging 1.00
R4875:Zfp827 UTSW 8 79060774 missense probably damaging 1.00
R4936:Zfp827 UTSW 8 79061183 missense probably benign
R4965:Zfp827 UTSW 8 79061281 missense probably benign
R5103:Zfp827 UTSW 8 79070403 missense probably damaging 1.00
R5366:Zfp827 UTSW 8 79185704 missense possibly damaging 0.94
R5794:Zfp827 UTSW 8 79070442 missense probably damaging 1.00
R5825:Zfp827 UTSW 8 79179016 missense probably damaging 1.00
R6118:Zfp827 UTSW 8 79076438 missense possibly damaging 0.75
R6236:Zfp827 UTSW 8 79070476 missense probably damaging 1.00
R6263:Zfp827 UTSW 8 79179073 missense probably damaging 1.00
R6306:Zfp827 UTSW 8 79060695 missense probably damaging 1.00
R6490:Zfp827 UTSW 8 79189977 utr 3 prime probably benign
R6497:Zfp827 UTSW 8 79180128 missense probably damaging 1.00
R7250:Zfp827 UTSW 8 79190092 missense
R7443:Zfp827 UTSW 8 79190418 missense
R7708:Zfp827 UTSW 8 79175962 missense probably damaging 1.00
R7754:Zfp827 UTSW 8 79190329 missense
R7836:Zfp827 UTSW 8 79186350 missense probably damaging 1.00
R7919:Zfp827 UTSW 8 79186350 missense probably damaging 1.00
R7995:Zfp827 UTSW 8 79118258 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- TACTAAAGCTCCCTCCAATTGC -3'
(R):5'- GTGTGGTCTTGAACAGGCAC -3'

Sequencing Primer
(F):5'- AATTGCTTCTTCCCCTGGCAG -3'
(R):5'- GGTCTTGAACAGGCACTCTCC -3'
Posted On2019-06-26