Incidental Mutation 'R7290:Gal3st1'
ID 566333
Institutional Source Beutler Lab
Gene Symbol Gal3st1
Ensembl Gene ENSMUSG00000049721
Gene Name galactose-3-O-sulfotransferase 1
Synonyms galactosylceramide sulfotransferase, Gcst, Cst, 3'-phosphoadenylylsulfate-galactosylceramide 3'-sulfotransferase, GalCer sulfotransferase
MMRRC Submission 045362-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7290 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 3933636-3949326 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 3948093 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 100 (Q100L)
Ref Sequence ENSEMBL: ENSMUSP00000058348 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063004] [ENSMUST00000078757] [ENSMUST00000109981]
AlphaFold Q9JHE4
Predicted Effect possibly damaging
Transcript: ENSMUST00000063004
AA Change: Q100L

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000058348
Gene: ENSMUSG00000049721
AA Change: Q100L

DomainStartEndE-ValueType
Pfam:Gal-3-0_sulfotr 1 408 1.2e-184 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000078757
AA Change: Q100L

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000077815
Gene: ENSMUSG00000049721
AA Change: Q100L

DomainStartEndE-ValueType
Pfam:Gal-3-0_sulfotr 1 408 1.2e-184 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000109981
AA Change: Q100L

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000105608
Gene: ENSMUSG00000049721
AA Change: Q100L

DomainStartEndE-ValueType
Pfam:Gal-3-0_sulfotr 1 408 1.2e-184 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sulfonation, an important step in the metabolism of many drugs, xenobiotics, hormones, and neurotransmitters, is catalyzed by sulfotransferases. This gene encodes galactosylceramide sulfotransferase, which catalyzes the sulfation of membrane glycolipids including the final step in the synthesis of sulfatide, a major lipid component of the myelin sheath. This gene exhibits elevated expression in ovarian epithelial carcinoma and the encoded enzyme exhibits elevated activity in renal cell carcinoma. Mutations in this gene may be associated with reduced insulin resistance. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit hindlimb weakness and progressive ataxia beginning at six weeks of age. Homozygous males exhibit sterility with a block in spermatogenesis prior to the first meiotic division. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a T A 11: 109,921,714 (GRCm39) M1447L probably benign Het
Adam30 G A 3: 98,070,257 (GRCm39) V697I probably benign Het
Adamts12 A G 15: 11,277,452 (GRCm39) N689D probably benign Het
Adamts15 T C 9: 30,813,906 (GRCm39) K753R probably benign Het
Adra2a T C 19: 54,034,835 (GRCm39) F64L probably damaging Het
Ankub1 A G 3: 57,580,345 (GRCm39) L104P probably damaging Het
Arel1 A G 12: 84,988,719 (GRCm39) V10A probably benign Het
Atad2 A T 15: 57,962,047 (GRCm39) N1165K probably benign Het
Atp6v0d2 T A 4: 19,880,060 (GRCm39) D279V probably benign Het
Cadps A T 14: 12,616,099 (GRCm38) D310E probably damaging Het
Caskin2 T C 11: 115,695,615 (GRCm39) I249V possibly damaging Het
Cdh23 T C 10: 60,212,620 (GRCm39) N1598S probably benign Het
Cep250 A T 2: 155,834,682 (GRCm39) Q2202H probably benign Het
Ces5a T A 8: 94,261,311 (GRCm39) T35S probably damaging Het
Cnot11 G A 1: 39,579,020 (GRCm39) W295* probably null Het
Cntnap5a G T 1: 116,149,619 (GRCm39) W565L probably damaging Het
Dgka T C 10: 128,569,468 (GRCm39) E148G probably damaging Het
Dnah14 G A 1: 181,455,739 (GRCm39) D955N probably benign Het
Erbin G A 13: 103,998,834 (GRCm39) T184I probably damaging Het
Fam20c G T 5: 138,793,309 (GRCm39) G477W probably damaging Het
Fan1 T A 7: 64,022,234 (GRCm39) N340Y probably damaging Het
Fgfr4 T C 13: 55,309,262 (GRCm39) V433A probably benign Het
Gfra2 T C 14: 71,163,380 (GRCm39) F221S probably damaging Het
Gm19965 G A 1: 116,748,921 (GRCm39) V201M Het
Gnb1l A T 16: 18,382,806 (GRCm39) T282S probably benign Het
Gpr171 A T 3: 59,005,147 (GRCm39) N209K probably benign Het
Greb1 G A 12: 16,761,739 (GRCm39) T547I probably damaging Het
Ifi214 A T 1: 173,357,097 (GRCm39) V2E probably benign Het
Ighv1-71 T C 12: 115,706,267 (GRCm39) M1V probably null Het
Itm2b C T 14: 73,605,785 (GRCm39) G67D probably damaging Het
Kif21a A T 15: 90,851,432 (GRCm39) C995* probably null Het
Kifc2 A T 15: 76,544,904 (GRCm39) Y13F probably damaging Het
Lamb1 T A 12: 31,315,595 (GRCm39) V59D probably benign Het
Lhx1 A T 11: 84,412,703 (GRCm39) D163E probably damaging Het
Lrrc1 A T 9: 77,365,121 (GRCm39) Y187N probably benign Het
Map3k1 C A 13: 111,904,645 (GRCm39) V380F probably damaging Het
Mapk11 T C 15: 89,028,511 (GRCm39) D283G probably damaging Het
Mccc2 G T 13: 100,091,207 (GRCm39) A430D probably damaging Het
Mest A G 6: 30,747,158 (GRCm39) N340S unknown Het
Mms22l T C 4: 24,517,139 (GRCm39) L340P probably benign Het
Mrnip A G 11: 50,087,808 (GRCm39) Y110C possibly damaging Het
Mtmr4 A G 11: 87,502,063 (GRCm39) T706A probably benign Het
Muc21 G A 17: 35,929,761 (GRCm39) A1475V unknown Het
Ncstn A G 1: 171,900,373 (GRCm39) F234S probably benign Het
Nrp1 T C 8: 129,202,777 (GRCm39) probably null Het
Nup37 T G 10: 88,010,356 (GRCm39) C217G probably damaging Het
Or8g22 A G 9: 38,958,694 (GRCm39) L7P unknown Het
Pdzrn3 T C 6: 101,128,206 (GRCm39) N820S probably benign Het
Pgap1 A T 1: 54,587,225 (GRCm39) F117Y possibly damaging Het
Phip A T 9: 82,753,346 (GRCm39) F1799L possibly damaging Het
Ppm1f T A 16: 16,728,819 (GRCm39) F74I probably benign Het
Prpf8 C A 11: 75,384,783 (GRCm39) N775K possibly damaging Het
Ptdss2 T C 7: 140,731,693 (GRCm39) I167T possibly damaging Het
Ptpn18 G A 1: 34,501,892 (GRCm39) probably null Het
Rbl2 C A 8: 91,841,669 (GRCm39) A955D probably benign Het
Rgl1 A G 1: 152,420,146 (GRCm39) S366P possibly damaging Het
Rit2 A T 18: 31,376,221 (GRCm39) M38K possibly damaging Het
Robo1 A G 16: 72,801,408 (GRCm39) M1011V probably benign Het
Senp6 A T 9: 80,043,797 (GRCm39) E809D probably benign Het
Stard3 G A 11: 98,269,045 (GRCm39) probably null Het
Taar3 T G 10: 23,826,298 (GRCm39) Y281* probably null Het
Tacc2 G T 7: 130,331,103 (GRCm39) K352N probably benign Het
Tamalin G A 15: 101,129,419 (GRCm39) S234N probably damaging Het
Tasor T A 14: 27,160,610 (GRCm39) I124N probably damaging Het
Tdpoz4 G A 3: 93,704,155 (GRCm39) V151I not run Het
Tenm2 A G 11: 35,914,298 (GRCm39) L2413P probably damaging Het
Tgm6 T C 2: 129,983,110 (GRCm39) V233A probably damaging Het
Tlx3 G A 11: 33,153,514 (GRCm39) probably benign Het
Tmem94 G T 11: 115,677,082 (GRCm39) R118L possibly damaging Het
Trim23 C A 13: 104,323,941 (GRCm39) H133Q probably damaging Het
Unc80 A T 1: 66,640,356 (GRCm39) D1421V probably damaging Het
Vmn1r172 A G 7: 23,360,048 (GRCm39) N311S unknown Het
Vps25 T A 11: 101,149,775 (GRCm39) L153Q probably damaging Het
Wbp1l G T 19: 46,611,876 (GRCm39) probably benign Het
Ythdc2 A G 18: 44,970,558 (GRCm39) I291V possibly damaging Het
Zfp2 A G 11: 50,791,570 (GRCm39) C158R probably damaging Het
Zfp786 G A 6: 47,796,929 (GRCm39) P670S probably damaging Het
Zfp827 G A 8: 79,916,442 (GRCm39) R339H possibly damaging Het
Zmym6 C T 4: 127,017,294 (GRCm39) A1025V possibly damaging Het
Other mutations in Gal3st1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Gal3st1 APN 11 3,949,070 (GRCm39) utr 3 prime probably benign
IGL01010:Gal3st1 APN 11 3,946,914 (GRCm39) utr 5 prime probably benign
IGL01079:Gal3st1 APN 11 3,948,564 (GRCm39) missense probably damaging 1.00
IGL01306:Gal3st1 APN 11 3,948,405 (GRCm39) missense probably damaging 1.00
IGL01614:Gal3st1 APN 11 3,948,996 (GRCm39) missense probably damaging 1.00
IGL01990:Gal3st1 APN 11 3,948,741 (GRCm39) missense probably damaging 1.00
IGL02439:Gal3st1 APN 11 3,948,110 (GRCm39) missense possibly damaging 0.95
R0306:Gal3st1 UTSW 11 3,948,546 (GRCm39) missense probably damaging 1.00
R1075:Gal3st1 UTSW 11 3,948,509 (GRCm39) missense possibly damaging 0.80
R1171:Gal3st1 UTSW 11 3,948,931 (GRCm39) missense probably damaging 1.00
R1874:Gal3st1 UTSW 11 3,948,231 (GRCm39) missense probably damaging 1.00
R2230:Gal3st1 UTSW 11 3,948,282 (GRCm39) missense probably benign 0.31
R2231:Gal3st1 UTSW 11 3,948,282 (GRCm39) missense probably benign 0.31
R2232:Gal3st1 UTSW 11 3,948,282 (GRCm39) missense probably benign 0.31
R2985:Gal3st1 UTSW 11 3,948,618 (GRCm39) missense probably damaging 1.00
R3552:Gal3st1 UTSW 11 3,948,110 (GRCm39) missense possibly damaging 0.90
R6737:Gal3st1 UTSW 11 3,948,903 (GRCm39) missense probably benign 0.00
R7027:Gal3st1 UTSW 11 3,949,002 (GRCm39) missense probably damaging 0.96
R7106:Gal3st1 UTSW 11 3,948,509 (GRCm39) missense probably damaging 1.00
R7288:Gal3st1 UTSW 11 3,948,651 (GRCm39) missense probably damaging 0.98
R7288:Gal3st1 UTSW 11 3,948,609 (GRCm39) missense probably damaging 1.00
R7438:Gal3st1 UTSW 11 3,948,227 (GRCm39) missense probably benign 0.00
R7934:Gal3st1 UTSW 11 3,948,405 (GRCm39) missense probably damaging 1.00
R9046:Gal3st1 UTSW 11 3,948,278 (GRCm39) missense probably benign 0.05
R9475:Gal3st1 UTSW 11 3,948,660 (GRCm39) missense probably damaging 1.00
RF020:Gal3st1 UTSW 11 3,948,153 (GRCm39) missense possibly damaging 0.75
Z1088:Gal3st1 UTSW 11 3,947,984 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATGGTACTGTCACCCGCAAC -3'
(R):5'- ACCACGGATCCAAAGTAGTGG -3'

Sequencing Primer
(F):5'- CGCAACCCGCTGACTTC -3'
(R):5'- TGATGAAGGTGGCACCCG -3'
Posted On 2019-06-26