Mutagenetix > Incidental Mutations

Incidental Mutation 'R7290:Prpf8'

566338

Institutional Source

Beutler Lab

Gene Symbol

Prpf8

Ensembl Gene

ENSMUSG00000020850

Gene Name

pre-mRNA processing factor 8

Synonyms

Sfprp8l, D11Bwg0410e, DBF3/PRP8, Prp8

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.956) question?

Stock #

R7290 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

75486816-75509449 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 75493957 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 775 (N775K)

Ref Sequence

ENSEMBL: ENSMUSP00000018449 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018449] [ENSMUST00000102510] [ENSMUST00000131283]

AlphaFold

Q99PV0

Predicted Effect

possibly damaging
Transcript: ENSMUST00000018449
AA Change: N775K

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000018449
Gene: ENSMUSG00000020850
AA Change: N775K

Domain	Start	End	E-Value	Type
Pfam:PRO8NT	58	209	1.6e-84	PFAM
low complexity region	369	388	N/A	INTRINSIC
Pfam:PROCN	393	801	3.6e-226	PFAM
low complexity region	802	814	N/A	INTRINSIC
Pfam:RRM_4	986	1079	7.1e-49	PFAM
Pfam:U5_2-snRNA_bdg	1208	1343	1.9e-73	PFAM
Pfam:U6-snRNA_bdg	1442	1601	3.7e-97	PFAM
Pfam:PRP8_domainIV	1760	1990	1.5e-132	PFAM
JAB_MPN	2099	2233	9.02e-30	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102510
AA Change: N775K

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000099568
Gene: ENSMUSG00000020850
AA Change: N775K

Domain	Start	End	E-Value	Type
Pfam:PRO8NT	58	209	1.6e-90	PFAM
low complexity region	369	388	N/A	INTRINSIC
Pfam:PROCN	395	801	2.9e-239	PFAM
low complexity region	802	814	N/A	INTRINSIC
Pfam:RRM_4	986	1077	1.5e-51	PFAM
Pfam:U5_2-snRNA_bdg	1210	1343	1.1e-77	PFAM
Pfam:U6-snRNA_bdg	1442	1600	4.2e-97	PFAM
Pfam:PRP8_domainIV	1760	1989	9.8e-134	PFAM
JAB_MPN	2099	2233	9.02e-30	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000131283
AA Change: N720K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000115635
Gene: ENSMUSG00000020850
AA Change: N720K

Domain	Start	End	E-Value	Type
Pfam:PRO8NT	58	92	1.9e-13	PFAM
Pfam:PRO8NT	90	154	2.5e-30	PFAM
low complexity region	314	333	N/A	INTRINSIC
Pfam:PROCN	338	746	1.7e-226	PFAM
low complexity region	747	759	N/A	INTRINSIC
Pfam:RRM_4	931	1024	5.3e-49	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Pre-mRNA splicing occurs in 2 sequential transesterification steps. The protein encoded by this gene is a component of both U2- and U12-dependent spliceosomes, and found to be essential for the catalytic step II in pre-mRNA splicing process. It contains several WD repeats, which function in protein-protein interactions. This protein has a sequence similarity to yeast Prp8 protein. This gene is a candidate gene for autosomal dominant retinitis pigmentosa. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice that are either heterozygous or homozygous for a knock-in allele exhibit abnormal retinal pigment epithelium morphology and late-onset retinal degeneration. These changes are more severe in homozygous mutant mice. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8a	T	A	11: 110,030,888	M1447L	probably benign	Het
Adam30	G	A	3: 98,162,941	V697I	probably benign	Het
Adamts12	A	G	15: 11,277,366	N689D	probably benign	Het
Adamts15	T	C	9: 30,902,610	K753R	probably benign	Het
Adra2a	T	C	19: 54,046,404	F64L	probably damaging	Het
Ankub1	A	G	3: 57,672,924	L104P	probably damaging	Het
Arel1	A	G	12: 84,941,945	V10A	probably benign	Het
Atad2	A	T	15: 58,098,651	N1165K	probably benign	Het
Atp6v0d2	T	A	4: 19,880,060	D279V	probably benign	Het
Cadps	A	T	14: 12,616,099	D310E	probably damaging	Het
Caskin2	T	C	11: 115,804,789	I249V	possibly damaging	Het
Cdh23	T	C	10: 60,376,841	N1598S	probably benign	Het
Cep250	A	T	2: 155,992,762	Q2202H	probably benign	Het
Ces5a	T	A	8: 93,534,683	T35S	probably damaging	Het
Cnot11	G	A	1: 39,539,939	W295*	probably null	Het
Cntnap5a	G	T	1: 116,221,889	W565L	probably damaging	Het
Dgka	T	C	10: 128,733,599	E148G	probably damaging	Het
Dnah14	G	A	1: 181,628,174	D955N	probably benign	Het
Erbin	G	A	13: 103,862,326	T184I	probably damaging	Het
Fam208a	T	A	14: 27,438,653	I124N	probably damaging	Het
Fam20c	G	T	5: 138,807,554	G477W	probably damaging	Het
Fan1	T	A	7: 64,372,486	N340Y	probably damaging	Het
Fgfr4	T	C	13: 55,161,449	V433A	probably benign	Het
Gal3st1	A	T	11: 3,998,093	Q100L	possibly damaging	Het
Gfra2	T	C	14: 70,925,940	F221S	probably damaging	Het
Gm19965	G	A	1: 116,821,191	V201M		Het
Gm9573	G	A	17: 35,618,869	A1475V	unknown	Het
Gnb1l	A	T	16: 18,564,056	T282S	probably benign	Het
Gpr171	A	T	3: 59,097,726	N209K	probably benign	Het
Grasp	G	A	15: 101,231,538	S234N	probably damaging	Het
Greb1	G	A	12: 16,711,738	T547I	probably damaging	Het
Ifi214	A	T	1: 173,529,531	V2E	probably benign	Het
Ighv1-71	T	C	12: 115,742,647	M1V	probably null	Het
Itm2b	C	T	14: 73,368,345	G67D	probably damaging	Het
Kif21a	A	T	15: 90,967,229	C995*	probably null	Het
Kifc2	A	T	15: 76,660,704	Y13F	probably damaging	Het
Lamb1	T	A	12: 31,265,596	V59D	probably benign	Het
Lhx1	A	T	11: 84,521,877	D163E	probably damaging	Het
Lrrc1	A	T	9: 77,457,839	Y187N	probably benign	Het
Map3k1	C	A	13: 111,768,111	V380F	probably damaging	Het
Mapk11	T	C	15: 89,144,308	D283G	probably damaging	Het
Mccc2	G	T	13: 99,954,699	A430D	probably damaging	Het
Mest	A	G	6: 30,747,159	N340S	unknown	Het
Mms22l	T	C	4: 24,517,139	L340P	probably benign	Het
Mrnip	A	G	11: 50,196,981	Y110C	possibly damaging	Het
Mtmr4	A	G	11: 87,611,237	T706A	probably benign	Het
Ncstn	A	G	1: 172,072,806	F234S	probably benign	Het
Nrp1	T	C	8: 128,476,296		probably null	Het
Nup37	T	G	10: 88,174,494	C217G	probably damaging	Het
Olfr936	A	G	9: 39,047,398	L7P	unknown	Het
Pdzrn3	T	C	6: 101,151,245	N820S	probably benign	Het
Pgap1	A	T	1: 54,548,066	F117Y	possibly damaging	Het
Phip	A	T	9: 82,871,293	F1799L	possibly damaging	Het
Ppm1f	T	A	16: 16,910,955	F74I	probably benign	Het
Ptdss2	T	C	7: 141,151,780	I167T	possibly damaging	Het
Ptpn18	G	A	1: 34,462,811		probably null	Het
Rbl2	C	A	8: 91,115,041	A955D	probably benign	Het
Rgl1	A	G	1: 152,544,395	S366P	possibly damaging	Het
Rit2	A	T	18: 31,243,168	M38K	possibly damaging	Het
Robo1	A	G	16: 73,004,520	M1011V	probably benign	Het
Senp6	A	T	9: 80,136,515	E809D	probably benign	Het
Stard3	G	A	11: 98,378,219		probably null	Het
Taar3	T	G	10: 23,950,400	Y281*	probably null	Het
Tacc2	G	T	7: 130,729,373	K352N	probably benign	Het
Tdpoz4	G	A	3: 93,796,848	V151I	not run	Het
Tenm2	A	G	11: 36,023,471	L2413P	probably damaging	Het
Tgm6	T	C	2: 130,141,190	V233A	probably damaging	Het
Tlx3	G	A	11: 33,203,514		probably benign	Het
Tmem94	G	T	11: 115,786,256	R118L	possibly damaging	Het
Trim23	C	A	13: 104,187,433	H133Q	probably damaging	Het
Unc80	A	T	1: 66,601,197	D1421V	probably damaging	Het
Vmn1r172	A	G	7: 23,660,623	N311S	unknown	Het
Vps25	T	A	11: 101,258,949	L153Q	probably damaging	Het
Wbp1l	G	T	19: 46,623,437		probably benign	Het
Ythdc2	A	G	18: 44,837,491	I291V	possibly damaging	Het
Zfp2	A	G	11: 50,900,743	C158R	probably damaging	Het
Zfp786	G	A	6: 47,819,995	P670S	probably damaging	Het
Zfp827	G	A	8: 79,189,813	R339H	possibly damaging	Het
Zmym6	C	T	4: 127,123,501	A1025V	possibly damaging	Het

Other mutations in Prpf8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01375:Prpf8	APN	11	75494295	missense	possibly damaging	0.94
IGL01376:Prpf8	APN	11	75494295	missense	possibly damaging	0.94
IGL01393:Prpf8	APN	11	75494295	missense	possibly damaging	0.94
IGL01395:Prpf8	APN	11	75494295	missense	possibly damaging	0.94
IGL01554:Prpf8	APN	11	75495646	missense	probably damaging	1.00
IGL01560:Prpf8	APN	11	75490406	missense	possibly damaging	0.55
IGL01886:Prpf8	APN	11	75495744	missense	probably benign	0.32
IGL01946:Prpf8	APN	11	75499992	missense	probably damaging	1.00
IGL02022:Prpf8	APN	11	75501834	nonsense	probably null
IGL02077:Prpf8	APN	11	75495809	missense	probably damaging	0.96
IGL02141:Prpf8	APN	11	75490672	missense	possibly damaging	0.68
IGL02455:Prpf8	APN	11	75509258	missense	probably benign	0.32
cutter	UTSW	11	75495426	splice site	probably null
BB009:Prpf8	UTSW	11	75492597	missense	possibly damaging	0.92
BB019:Prpf8	UTSW	11	75492597	missense	possibly damaging	0.92
PIT4514001:Prpf8	UTSW	11	75496355	missense	possibly damaging	0.53
R0254:Prpf8	UTSW	11	75506362	missense	possibly damaging	0.93
R0270:Prpf8	UTSW	11	75505249	missense	probably damaging	0.99
R0504:Prpf8	UTSW	11	75501942	splice site	probably benign
R0573:Prpf8	UTSW	11	75490654	missense	probably damaging	1.00
R0613:Prpf8	UTSW	11	75503444	missense	probably damaging	1.00
R0893:Prpf8	UTSW	11	75493949	missense	probably damaging	1.00
R0967:Prpf8	UTSW	11	75494430	missense	probably damaging	1.00
R0975:Prpf8	UTSW	11	75508674	unclassified	probably benign
R1123:Prpf8	UTSW	11	75495285	missense	probably damaging	1.00
R1183:Prpf8	UTSW	11	75490330	missense	possibly damaging	0.95
R1857:Prpf8	UTSW	11	75495423	critical splice donor site	probably null
R1901:Prpf8	UTSW	11	75504744	missense	probably damaging	0.99
R1950:Prpf8	UTSW	11	75496511	missense	possibly damaging	0.72
R2116:Prpf8	UTSW	11	75487721	missense	possibly damaging	0.51
R2147:Prpf8	UTSW	11	75490531	missense	probably benign
R2185:Prpf8	UTSW	11	75487113	nonsense	probably null
R2271:Prpf8	UTSW	11	75495363	missense	probably damaging	1.00
R2272:Prpf8	UTSW	11	75495363	missense	probably damaging	1.00
R2898:Prpf8	UTSW	11	75496034	missense	probably benign	0.00
R3744:Prpf8	UTSW	11	75506721	splice site	probably null
R3893:Prpf8	UTSW	11	75500257	missense	possibly damaging	0.73
R4400:Prpf8	UTSW	11	75490702	missense	possibly damaging	0.63
R4510:Prpf8	UTSW	11	75491826	missense	probably damaging	0.96
R4511:Prpf8	UTSW	11	75491826	missense	probably damaging	0.96
R4784:Prpf8	UTSW	11	75492505	missense	probably damaging	1.00
R5089:Prpf8	UTSW	11	75509228	splice site	probably null
R5186:Prpf8	UTSW	11	75489783	missense	possibly damaging	0.93
R5215:Prpf8	UTSW	11	75500204	missense	probably benign	0.02
R5288:Prpf8	UTSW	11	75495799	missense	probably damaging	1.00
R5362:Prpf8	UTSW	11	75506410	missense	possibly damaging	0.53
R5384:Prpf8	UTSW	11	75495799	missense	probably damaging	1.00
R5386:Prpf8	UTSW	11	75495799	missense	probably damaging	1.00
R5423:Prpf8	UTSW	11	75508958	missense	probably damaging	1.00
R5472:Prpf8	UTSW	11	75503643	missense	possibly damaging	0.89
R5539:Prpf8	UTSW	11	75503638	missense	probably benign	0.20
R5620:Prpf8	UTSW	11	75505101	missense	possibly damaging	0.95
R5669:Prpf8	UTSW	11	75504738	missense	probably damaging	1.00
R5887:Prpf8	UTSW	11	75500908	missense	possibly damaging	0.87
R5948:Prpf8	UTSW	11	75509189	missense	possibly damaging	0.95
R6073:Prpf8	UTSW	11	75494022	critical splice donor site	probably null
R6250:Prpf8	UTSW	11	75493508	missense	possibly damaging	0.95
R6358:Prpf8	UTSW	11	75491495	missense	probably benign	0.33
R6629:Prpf8	UTSW	11	75495426	splice site	probably null
R6804:Prpf8	UTSW	11	75499809	missense	possibly damaging	0.71
R6922:Prpf8	UTSW	11	75490736	missense	probably damaging	1.00
R7035:Prpf8	UTSW	11	75504828	missense	possibly damaging	0.72
R7038:Prpf8	UTSW	11	75496158	missense	probably benign	0.02
R7089:Prpf8	UTSW	11	75508548	missense	probably damaging	0.99
R7101:Prpf8	UTSW	11	75490400	missense	possibly damaging	0.85
R7114:Prpf8	UTSW	11	75503355	nonsense	probably null
R7182:Prpf8	UTSW	11	75490727	missense	possibly damaging	0.96
R7323:Prpf8	UTSW	11	75491784	missense	probably benign	0.32
R7485:Prpf8	UTSW	11	75508912	nonsense	probably null
R7522:Prpf8	UTSW	11	75509276	missense	possibly damaging	0.82
R7546:Prpf8	UTSW	11	75508374	missense	probably damaging	1.00
R7596:Prpf8	UTSW	11	75491504	missense	probably benign	0.03
R7699:Prpf8	UTSW	11	75500196	missense	probably benign	0.02
R7731:Prpf8	UTSW	11	75508906	missense	probably damaging	0.97
R7821:Prpf8	UTSW	11	75494474	missense	probably benign	0.01
R7932:Prpf8	UTSW	11	75492597	missense	possibly damaging	0.92
R8039:Prpf8	UTSW	11	75502542	missense	possibly damaging	0.95
R8067:Prpf8	UTSW	11	75500150	missense	probably damaging	0.98
R8316:Prpf8	UTSW	11	75499815	missense	possibly damaging	0.71
R8560:Prpf8	UTSW	11	75491774	nonsense	probably null
R8823:Prpf8	UTSW	11	75493456	missense	probably benign	0.05
R8977:Prpf8	UTSW	11	75496044	missense	probably benign	0.12
R9116:Prpf8	UTSW	11	75489763	missense	possibly damaging	0.71
R9166:Prpf8	UTSW	11	75496514	missense	possibly damaging	0.53
R9360:Prpf8	UTSW	11	75490330	missense	possibly damaging	0.95
R9453:Prpf8	UTSW	11	75506386	missense	possibly damaging	0.56
X0028:Prpf8	UTSW	11	75506764	missense	probably damaging	0.99
Z1177:Prpf8	UTSW	11	75503334	missense	probably benign	0.35

Predicted Primers

PCR Primer
(F):5'- TCACAGGACTGTCCACCTTC -3'
(R):5'- AGGTGAACGTCAGGTTAGTCTC -3'

Sequencing Primer
(F):5'- GCTGGTCTCAGACTCAAGAGATC -3'
(R):5'- GAACGTCAGGTTAGTCTCCCACTAC -3'

Posted On

2019-06-26