Mutagenetix > Incidental Mutations

Incidental Mutation 'R0635:Scel'

56635

Institutional Source

Beutler Lab

Gene Symbol

Scel

Ensembl Gene

ENSMUSG00000022123

Gene Name

sciellin

Synonyms

9230114I02Rik

MMRRC Submission

038824-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0635 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

103513342-103612797 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to A at 103583139 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000154402 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095576] [ENSMUST00000227322]

Predicted Effect

probably null
Transcript: ENSMUST00000095576

SMART Domains

Protein: ENSMUSP00000093233
Gene: ENSMUSG00000022123

Domain	Start	End	E-Value	Type
low complexity region	111	131	N/A	INTRINSIC
low complexity region	159	178	N/A	INTRINSIC
internal_repeat_1	204	327	9.24e-7	PROSPERO
internal_repeat_1	378	505	9.24e-7	PROSPERO
low complexity region	525	537	N/A	INTRINSIC
LIM	584	642	2.23e-3	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000227322

Meta Mutation Damage Score

0.9487

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.4%
20x: 94.9%

Validation Efficiency

99% (68/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a precursor to the cornified envelope of terminally differentiated keratinocytes. This protein localizes to the periphery of cells and may function in the assembly or regulation of proteins in the cornified envelope. Transcript variants encoding different isoforms exist. A transcript variant utilizing an alternative polyA signal has been described in the literature, but its full-length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable and fertile with normal hair morphology and development and normal skin morphology and barrier function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3632451O06Rik	A	G	14: 49,773,143	L369S	probably benign	Het
4932429P05Rik	T	C	X: 89,752,522		probably benign	Het
5730455P16Rik	A	T	11: 80,374,065		probably benign	Het
Adamts15	A	G	9: 30,904,770	L631P	probably damaging	Het
Adamts17	T	C	7: 66,908,605	F266L	probably damaging	Het
Adgrb1	C	A	15: 74,540,892	Q488K	possibly damaging	Het
Cep290	A	G	10: 100,492,676	D109G	probably damaging	Het
Chil5	A	T	3: 106,017,203	Y229N	possibly damaging	Het
Cntnap1	A	G	11: 101,183,459	T742A	probably benign	Het
Col6a3	A	T	1: 90,808,086		probably null	Het
Col6a5	G	A	9: 105,928,606	P1034S	unknown	Het
Daxx	T	A	17: 33,912,644	D442E	probably benign	Het
Dmxl1	T	C	18: 49,851,423		probably benign	Het
Dnah11	A	G	12: 118,007,996	F2942S	probably damaging	Het
Fam71a	T	C	1: 191,163,727	T240A	probably benign	Het
Glg1	A	G	8: 111,163,764		probably benign	Het
Gm10272	G	A	10: 77,706,701		probably benign	Het
Gm17333	AAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAA	AAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAA	16: 77,852,878		noncoding transcript	Het
Haao	A	G	17: 83,838,574	F83S	probably damaging	Het
Hdgfl2	T	A	17: 56,096,057	L177Q	probably damaging	Het
Hrh1	T	C	6: 114,480,145	V129A	probably damaging	Het
Ift43	T	A	12: 86,085,081		probably benign	Het
Il21r	T	C	7: 125,632,506	Y369H	probably damaging	Het
Il2ra	C	T	2: 11,680,366	T171M	probably benign	Het
Lao1	C	T	4: 118,968,296	R438C	probably benign	Het
Lrrcc1	G	A	3: 14,559,228	S350N	probably benign	Het
Mageb5	T	A	X: 91,779,993	Y260F	probably benign	Het
March5	A	T	19: 37,220,408	I159F	possibly damaging	Het
Mgat4a	G	A	1: 37,452,294	A282V	probably benign	Het
Mipep	G	A	14: 60,829,390	V420I	probably damaging	Het
Morc2b	A	T	17: 33,137,687	F370L	possibly damaging	Het
Mt1	A	T	8: 94,179,821		probably null	Het
Ncapd2	A	G	6: 125,173,036	V943A	probably benign	Het
Nkd2	T	C	13: 73,826,894	D58G	probably benign	Het
Nol8	C	G	13: 49,676,758	S1106C	probably benign	Het
Nrm	C	A	17: 35,864,264	Y61*	probably null	Het
Nusap1	A	G	2: 119,627,667	T95A	probably damaging	Het
Ocln	T	A	13: 100,506,236	Q197L	probably damaging	Het
Olfr495	T	A	7: 108,395,764	F215I	probably benign	Het
Oxtr	A	G	6: 112,489,200	Y200H	probably damaging	Het
Paip2b	T	C	6: 83,809,909	E115G	possibly damaging	Het
Pcm1	T	A	8: 41,267,179		probably benign	Het
Pcnt	T	C	10: 76,404,585	D1205G	probably damaging	Het
Phka1	G	A	X: 102,621,400	R186C	probably damaging	Het
Pik3cb	A	G	9: 99,064,218		probably benign	Het
Pik3r1	C	T	13: 101,757,418	R81K	probably benign	Het
Ppa1	A	G	10: 61,665,440	D162G	probably benign	Het
Ppa1	A	G	10: 61,666,970	R191G	probably damaging	Het
Prss22	T	A	17: 23,996,688	T87S	probably benign	Het
Rgr	T	A	14: 37,038,947	R218*	probably null	Het
Rreb1	A	T	13: 37,941,564	Q1282L	possibly damaging	Het
Sema6b	A	G	17: 56,129,971		probably null	Het
Slc4a1	T	C	11: 102,352,672	E711G	possibly damaging	Het
Snx19	C	A	9: 30,428,810	L415M	probably damaging	Het
Snx19	T	G	9: 30,428,811	L415R	probably damaging	Het
Specc1	G	A	11: 62,118,903	R495Q	probably damaging	Het
Tead1	T	C	7: 112,891,706		probably benign	Het
Timm10b	A	C	7: 105,640,688		probably benign	Het
Ubxn7	T	A	16: 32,367,417		probably benign	Het
Vmn2r116	T	A	17: 23,386,887	Y258N	possibly damaging	Het
Vmn2r77	T	A	7: 86,811,175	F570I	probably benign	Het
Vmn2r98	T	C	17: 19,080,497	V587A	probably benign	Het
Zfp398	T	C	6: 47,863,140	I101T	probably damaging	Het
Zfp808	T	A	13: 62,172,419	H487Q	probably damaging	Het

Other mutations in Scel

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00841:Scel	APN	14	103529995	missense	probably benign	0.01
IGL00913:Scel	APN	14	103581809	missense	probably benign	0.35
IGL01086:Scel	APN	14	103612391	missense	probably benign	0.05
IGL01352:Scel	APN	14	103533338	missense	possibly damaging	0.54
IGL01396:Scel	APN	14	103608094	splice site	probably benign
IGL01954:Scel	APN	14	103603242	splice site	probably benign
IGL02064:Scel	APN	14	103533326	missense	probably damaging	0.98
IGL02186:Scel	APN	14	103564821	missense	probably benign	0.23
IGL02475:Scel	APN	14	103537008	missense	possibly damaging	0.95
IGL02926:Scel	APN	14	103576247	nonsense	probably null
IGL03122:Scel	APN	14	103599406	missense	possibly damaging	0.66
IGL03135:Scel	APN	14	103586514	missense	probably benign	0.02
PIT4585001:Scel	UTSW	14	103592368	missense	possibly damaging	0.90
R0346:Scel	UTSW	14	103529984	missense	probably damaging	1.00
R0394:Scel	UTSW	14	103562518	missense	probably benign	0.15
R0418:Scel	UTSW	14	103603254	missense	probably benign
R0815:Scel	UTSW	14	103586480	missense	possibly damaging	0.83
R0863:Scel	UTSW	14	103586480	missense	possibly damaging	0.83
R0990:Scel	UTSW	14	103581832	missense	possibly damaging	0.55
R1084:Scel	UTSW	14	103564843	critical splice donor site	probably null
R1641:Scel	UTSW	14	103533316	missense	probably damaging	1.00
R2001:Scel	UTSW	14	103610790	missense	possibly damaging	0.66
R2002:Scel	UTSW	14	103541985	missense	probably damaging	1.00
R2341:Scel	UTSW	14	103608170	missense	possibly damaging	0.92
R3425:Scel	UTSW	14	103608106	missense	possibly damaging	0.92
R3836:Scel	UTSW	14	103592386	missense	possibly damaging	0.66
R4035:Scel	UTSW	14	103530004	missense	probably damaging	1.00
R4197:Scel	UTSW	14	103599400	missense	probably damaging	0.97
R4737:Scel	UTSW	14	103572037	missense	possibly damaging	0.79
R4801:Scel	UTSW	14	103583100	missense	probably benign	0.01
R4802:Scel	UTSW	14	103583100	missense	probably benign	0.01
R5369:Scel	UTSW	14	103586493	missense	probably benign	0.00
R5555:Scel	UTSW	14	103602206	missense	probably benign	0.27
R5582:Scel	UTSW	14	103583139	critical splice donor site	probably benign
R5931:Scel	UTSW	14	103605624	nonsense	probably null
R5978:Scel	UTSW	14	103529254	splice site	probably null
R6045:Scel	UTSW	14	103592213	missense	probably benign	0.12
R6062:Scel	UTSW	14	103585136	missense	possibly damaging	0.82
R6218:Scel	UTSW	14	103572042	missense	probably benign	0.12
R6225:Scel	UTSW	14	103591984	missense	probably benign	0.27
R7102:Scel	UTSW	14	103543832	nonsense	probably null
R7349:Scel	UTSW	14	103543879	missense	probably benign	0.11
R8376:Scel	UTSW	14	103572015	missense	probably benign	0.02
X0026:Scel	UTSW	14	103591993	missense	possibly damaging	0.46

Predicted Primers

PCR Primer
(F):5'- TTCAGCAAAATGGCTGCTGTCAAGG -3'
(R):5'- TACCCTGGAGTAAGGTCACCACTG -3'

Sequencing Primer
(F):5'- AAAATGGCTGCTGTCAAGGTTTTAG -3'
(R):5'- AGGTCACCACTGTACTTTGAG -3'

Posted On

2013-07-11