Incidental Mutation 'R7290:Gfra2'
ID566357
Institutional Source Beutler Lab
Gene Symbol Gfra2
Ensembl Gene ENSMUSG00000022103
Gene Nameglial cell line derived neurotrophic factor family receptor alpha 2
SynonymsGFR alpha-2, GFR alpha 2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.302) question?
Stock #R7290 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location70890120-70979838 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70925940 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 221 (F221S)
Ref Sequence ENSEMBL: ENSMUSP00000022699 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022699] [ENSMUST00000227697]
Predicted Effect probably damaging
Transcript: ENSMUST00000022699
AA Change: F221S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022699
Gene: ENSMUSG00000022103
AA Change: F221S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
GDNF 40 117 1.76e-15 SMART
GDNF 161 241 3.7e-23 SMART
GDNF 251 347 1.74e-28 SMART
low complexity region 381 397 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000227697
AA Change: F88S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is part of the receptor complex that transduces glial cell-derived neurotrophic factor and neurturin signals by mediating autophosphorylation and activation of the RET receptor. Mice lacking this protein are viable and fertile but display growth retardation attributed to impaired salivary and pancreatic secretion and innervation deficits in the intestinal tract. In addition, knockout mice display neural defects including a failure to initiate outgrowth of dorsal ganglion root neurons, demonstrating a requirement in neuronal differentiation of these cells. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]
PHENOTYPE: Homozygous mutants have dry eyes, poor postweaning growth associated with impaired parasympathetic cholinergic innervation of lacrimal and salivary glands and of small intestine, reduced skin thickness and accelerated hair follicle regression. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a T A 11: 110,030,888 M1447L probably benign Het
Adam30 G A 3: 98,162,941 V697I probably benign Het
Adamts12 A G 15: 11,277,366 N689D probably benign Het
Adamts15 T C 9: 30,902,610 K753R probably benign Het
Adra2a T C 19: 54,046,404 F64L probably damaging Het
Ankub1 A G 3: 57,672,924 L104P probably damaging Het
Arel1 A G 12: 84,941,945 V10A probably benign Het
Atad2 A T 15: 58,098,651 N1165K probably benign Het
Atp6v0d2 T A 4: 19,880,060 D279V probably benign Het
Cadps A T 14: 12,616,099 D310E probably damaging Het
Caskin2 T C 11: 115,804,789 I249V possibly damaging Het
Cdh23 T C 10: 60,376,841 N1598S probably benign Het
Cep250 A T 2: 155,992,762 Q2202H probably benign Het
Ces5a T A 8: 93,534,683 T35S probably damaging Het
Cnot11 G A 1: 39,539,939 W295* probably null Het
Cntnap5a G T 1: 116,221,889 W565L probably damaging Het
Dgka T C 10: 128,733,599 E148G probably damaging Het
Dnah14 G A 1: 181,628,174 D955N probably benign Het
Erbin G A 13: 103,862,326 T184I probably damaging Het
Fam208a T A 14: 27,438,653 I124N probably damaging Het
Fam20c G T 5: 138,807,554 G477W probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fgfr4 T C 13: 55,161,449 V433A probably benign Het
Gal3st1 A T 11: 3,998,093 Q100L possibly damaging Het
Gm19965 G A 1: 116,821,191 V201M Het
Gm9573 G A 17: 35,618,869 A1475V unknown Het
Gnb1l A T 16: 18,564,056 T282S probably benign Het
Gpr171 A T 3: 59,097,726 N209K probably benign Het
Grasp G A 15: 101,231,538 S234N probably damaging Het
Greb1 G A 12: 16,711,738 T547I probably damaging Het
Ifi214 A T 1: 173,529,531 V2E probably benign Het
Ighv1-71 T C 12: 115,742,647 M1V probably null Het
Itm2b C T 14: 73,368,345 G67D probably damaging Het
Kif21a A T 15: 90,967,229 C995* probably null Het
Kifc2 A T 15: 76,660,704 Y13F probably damaging Het
Lamb1 T A 12: 31,265,596 V59D probably benign Het
Lhx1 A T 11: 84,521,877 D163E probably damaging Het
Lrrc1 A T 9: 77,457,839 Y187N probably benign Het
Map3k1 C A 13: 111,768,111 V380F probably damaging Het
Mapk11 T C 15: 89,144,308 D283G probably damaging Het
Mccc2 G T 13: 99,954,699 A430D probably damaging Het
Mest A G 6: 30,747,159 N340S unknown Het
Mms22l T C 4: 24,517,139 L340P probably benign Het
Mrnip A G 11: 50,196,981 Y110C possibly damaging Het
Mtmr4 A G 11: 87,611,237 T706A probably benign Het
Ncstn A G 1: 172,072,806 F234S probably benign Het
Nrp1 T C 8: 128,476,296 probably null Het
Nup37 T G 10: 88,174,494 C217G probably damaging Het
Olfr936 A G 9: 39,047,398 L7P unknown Het
Pdzrn3 T C 6: 101,151,245 N820S probably benign Het
Pgap1 A T 1: 54,548,066 F117Y possibly damaging Het
Phip A T 9: 82,871,293 F1799L possibly damaging Het
Ppm1f T A 16: 16,910,955 F74I probably benign Het
Prpf8 C A 11: 75,493,957 N775K possibly damaging Het
Ptdss2 T C 7: 141,151,780 I167T possibly damaging Het
Ptpn18 G A 1: 34,462,811 probably null Het
Rbl2 C A 8: 91,115,041 A955D probably benign Het
Rgl1 A G 1: 152,544,395 S366P possibly damaging Het
Rit2 A T 18: 31,243,168 M38K possibly damaging Het
Robo1 A G 16: 73,004,520 M1011V probably benign Het
Senp6 A T 9: 80,136,515 E809D probably benign Het
Stard3 G A 11: 98,378,219 probably null Het
Taar3 T G 10: 23,950,400 Y281* probably null Het
Tacc2 G T 7: 130,729,373 K352N probably benign Het
Tdpoz4 G A 3: 93,796,848 V151I not run Het
Tenm2 A G 11: 36,023,471 L2413P probably damaging Het
Tgm6 T C 2: 130,141,190 V233A probably damaging Het
Tlx3 G A 11: 33,203,514 probably benign Het
Tmem94 G T 11: 115,786,256 R118L possibly damaging Het
Trim23 C A 13: 104,187,433 H133Q probably damaging Het
Unc80 A T 1: 66,601,197 D1421V probably damaging Het
Vmn1r172 A G 7: 23,660,623 N311S unknown Het
Vps25 T A 11: 101,258,949 L153Q probably damaging Het
Wbp1l G T 19: 46,623,437 probably benign Het
Ythdc2 A G 18: 44,837,491 I291V possibly damaging Het
Zfp2 A G 11: 50,900,743 C158R probably damaging Het
Zfp786 G A 6: 47,819,995 P670S probably damaging Het
Zfp827 G A 8: 79,189,813 R339H possibly damaging Het
Zmym6 C T 4: 127,123,501 A1025V possibly damaging Het
Other mutations in Gfra2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Gfra2 APN 14 70968239 splice site probably benign
IGL01303:Gfra2 APN 14 70895852 missense probably benign 0.09
IGL01380:Gfra2 APN 14 70967146 splice site probably benign
IGL01528:Gfra2 APN 14 70966298 missense possibly damaging 0.95
IGL02203:Gfra2 APN 14 70967084 missense possibly damaging 0.69
IGL02270:Gfra2 APN 14 70925907 missense possibly damaging 0.78
IGL03104:Gfra2 APN 14 70968285 missense probably benign 0.00
IGL03270:Gfra2 APN 14 70925904 missense possibly damaging 0.80
H8562:Gfra2 UTSW 14 70978378 missense possibly damaging 0.94
H8786:Gfra2 UTSW 14 70978378 missense possibly damaging 0.94
R0423:Gfra2 UTSW 14 70896081 missense probably damaging 1.00
R4120:Gfra2 UTSW 14 70966275 missense probably damaging 1.00
R4172:Gfra2 UTSW 14 70896081 missense possibly damaging 0.80
R4712:Gfra2 UTSW 14 70925937 missense probably damaging 1.00
R4804:Gfra2 UTSW 14 70925921 missense possibly damaging 0.76
R4902:Gfra2 UTSW 14 70967015 missense probably damaging 1.00
R5424:Gfra2 UTSW 14 70895847 missense probably damaging 1.00
R6711:Gfra2 UTSW 14 70966275 missense probably damaging 1.00
R7322:Gfra2 UTSW 14 70968391 missense probably benign 0.00
R7814:Gfra2 UTSW 14 70895970 missense probably damaging 1.00
Z1177:Gfra2 UTSW 14 70978492 missense not run
Predicted Primers PCR Primer
(F):5'- GGTCACATGTGTCCATTCCC -3'
(R):5'- TTGTAACATAGGCCAACCACATG -3'

Sequencing Primer
(F):5'- TTTGCCTTCCAGGGACAGG -3'
(R):5'- TAGGCCAACCACATGAGCACG -3'
Posted On2019-06-26