Mutagenetix > Incidental Mutations

Incidental Mutation 'R7290:Kif21a'

566363

Institutional Source

Beutler Lab

Gene Symbol

Kif21a

Ensembl Gene

ENSMUSG00000022629

Gene Name

kinesin family member 21A

Synonyms

N-5 kinesin

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7290 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

90933276-91049948 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 90967229 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Stop codon at position 995 (C995*)

Ref Sequence

ENSEMBL: ENSMUSP00000104911 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067205] [ENSMUST00000088614] [ENSMUST00000100304] [ENSMUST00000109287] [ENSMUST00000109288] [ENSMUST00000229801]

AlphaFold

Q9QXL2

Predicted Effect

probably null
Transcript: ENSMUST00000067205
AA Change: C995*

SMART Domains

Protein: ENSMUSP00000066911
Gene: ENSMUSG00000022629
AA Change: C995*

Domain	Start	End	E-Value	Type
KISc	7	379	8.97e-163	SMART
Blast:KISc	469	513	9e-9	BLAST
low complexity region	514	525	N/A	INTRINSIC
low complexity region	542	557	N/A	INTRINSIC
low complexity region	571	585	N/A	INTRINSIC
low complexity region	589	628	N/A	INTRINSIC
low complexity region	700	713	N/A	INTRINSIC
coiled coil region	924	1008	N/A	INTRINSIC
coiled coil region	1043	1066	N/A	INTRINSIC
low complexity region	1101	1112	N/A	INTRINSIC
low complexity region	1222	1234	N/A	INTRINSIC
low complexity region	1251	1271	N/A	INTRINSIC
WD40	1290	1327	1.21e-7	SMART
WD40	1330	1368	7.28e-2	SMART
WD40	1394	1432	3.33e-1	SMART
WD40	1435	1477	7e-4	SMART
WD40	1485	1523	2.4e-1	SMART
WD40	1527	1566	1.48e-2	SMART
WD40	1569	1606	2.07e-6	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000088614
AA Change: C1008*

SMART Domains

Protein: ENSMUSP00000085985
Gene: ENSMUSG00000022629
AA Change: C1008*

Domain	Start	End	E-Value	Type
KISc	7	379	8.97e-163	SMART
Blast:KISc	469	513	1e-8	BLAST
low complexity region	514	525	N/A	INTRINSIC
low complexity region	542	564	N/A	INTRINSIC
low complexity region	584	598	N/A	INTRINSIC
low complexity region	602	641	N/A	INTRINSIC
low complexity region	713	726	N/A	INTRINSIC
coiled coil region	937	1021	N/A	INTRINSIC
coiled coil region	1056	1079	N/A	INTRINSIC
low complexity region	1114	1125	N/A	INTRINSIC
low complexity region	1271	1283	N/A	INTRINSIC
low complexity region	1300	1316	N/A	INTRINSIC
WD40	1334	1371	1.21e-7	SMART
WD40	1374	1412	7.28e-2	SMART
WD40	1438	1476	3.33e-1	SMART
WD40	1479	1521	7e-4	SMART
WD40	1529	1567	2.4e-1	SMART
WD40	1571	1610	1.48e-2	SMART
WD40	1613	1650	2.07e-6	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000100304
AA Change: C1008*

SMART Domains

Protein: ENSMUSP00000097877
Gene: ENSMUSG00000022629
AA Change: C1008*

Domain	Start	End	E-Value	Type
KISc	7	379	8.97e-163	SMART
Blast:KISc	469	513	1e-8	BLAST
low complexity region	514	525	N/A	INTRINSIC
low complexity region	542	564	N/A	INTRINSIC
low complexity region	584	598	N/A	INTRINSIC
low complexity region	602	641	N/A	INTRINSIC
low complexity region	713	726	N/A	INTRINSIC
coiled coil region	937	1021	N/A	INTRINSIC
coiled coil region	1056	1079	N/A	INTRINSIC
low complexity region	1271	1283	N/A	INTRINSIC
low complexity region	1300	1316	N/A	INTRINSIC
WD40	1334	1371	1.21e-7	SMART
WD40	1374	1412	7.28e-2	SMART
WD40	1438	1476	3.33e-1	SMART
WD40	1479	1521	7e-4	SMART
WD40	1529	1567	2.4e-1	SMART
WD40	1571	1610	1.48e-2	SMART
WD40	1613	1650	2.07e-6	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000109287
AA Change: C995*

SMART Domains

Protein: ENSMUSP00000104910
Gene: ENSMUSG00000022629
AA Change: C995*

Domain	Start	End	E-Value	Type
KISc	7	379	8.97e-163	SMART
Blast:KISc	469	513	9e-9	BLAST
low complexity region	514	525	N/A	INTRINSIC
low complexity region	542	557	N/A	INTRINSIC
low complexity region	571	585	N/A	INTRINSIC
low complexity region	589	628	N/A	INTRINSIC
low complexity region	700	713	N/A	INTRINSIC
coiled coil region	924	1008	N/A	INTRINSIC
coiled coil region	1043	1066	N/A	INTRINSIC
low complexity region	1101	1112	N/A	INTRINSIC
WD40	1229	1266	1.21e-7	SMART
WD40	1269	1307	7.28e-2	SMART
WD40	1333	1371	3.33e-1	SMART
WD40	1374	1416	7e-4	SMART
WD40	1424	1462	2.4e-1	SMART
WD40	1466	1505	1.48e-2	SMART
WD40	1508	1545	2.07e-6	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000109288
AA Change: C995*

SMART Domains

Protein: ENSMUSP00000104911
Gene: ENSMUSG00000022629
AA Change: C995*

Domain	Start	End	E-Value	Type
KISc	7	379	8.97e-163	SMART
Blast:KISc	469	513	9e-9	BLAST
low complexity region	514	525	N/A	INTRINSIC
low complexity region	542	557	N/A	INTRINSIC
low complexity region	571	585	N/A	INTRINSIC
low complexity region	589	628	N/A	INTRINSIC
low complexity region	700	713	N/A	INTRINSIC
coiled coil region	924	1008	N/A	INTRINSIC
coiled coil region	1043	1066	N/A	INTRINSIC
low complexity region	1205	1216	N/A	INTRINSIC
WD40	1235	1272	1.21e-7	SMART
WD40	1275	1313	7.28e-2	SMART
WD40	1339	1377	3.33e-1	SMART
WD40	1380	1422	7e-4	SMART
WD40	1430	1468	2.4e-1	SMART
WD40	1472	1511	1.48e-2	SMART
WD40	1514	1551	2.07e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000229801

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the KIF4 subfamily of kinesin-like motor proteins. The encoded protein is characterized by an N-terminal motor domain a coiled-coil stalk domain and a C-terminal WD-40 repeat domain. This protein may be involved in microtubule dependent transport. Mutations in this gene are the cause of congenital fibrosis of extraocular muscles-1. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Mar 2010]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8a	T	A	11: 110,030,888	M1447L	probably benign	Het
Adam30	G	A	3: 98,162,941	V697I	probably benign	Het
Adamts12	A	G	15: 11,277,366	N689D	probably benign	Het
Adamts15	T	C	9: 30,902,610	K753R	probably benign	Het
Adra2a	T	C	19: 54,046,404	F64L	probably damaging	Het
Ankub1	A	G	3: 57,672,924	L104P	probably damaging	Het
Arel1	A	G	12: 84,941,945	V10A	probably benign	Het
Atad2	A	T	15: 58,098,651	N1165K	probably benign	Het
Atp6v0d2	T	A	4: 19,880,060	D279V	probably benign	Het
Cadps	A	T	14: 12,616,099	D310E	probably damaging	Het
Caskin2	T	C	11: 115,804,789	I249V	possibly damaging	Het
Cdh23	T	C	10: 60,376,841	N1598S	probably benign	Het
Cep250	A	T	2: 155,992,762	Q2202H	probably benign	Het
Ces5a	T	A	8: 93,534,683	T35S	probably damaging	Het
Cnot11	G	A	1: 39,539,939	W295*	probably null	Het
Cntnap5a	G	T	1: 116,221,889	W565L	probably damaging	Het
Dgka	T	C	10: 128,733,599	E148G	probably damaging	Het
Dnah14	G	A	1: 181,628,174	D955N	probably benign	Het
Erbin	G	A	13: 103,862,326	T184I	probably damaging	Het
Fam208a	T	A	14: 27,438,653	I124N	probably damaging	Het
Fam20c	G	T	5: 138,807,554	G477W	probably damaging	Het
Fan1	T	A	7: 64,372,486	N340Y	probably damaging	Het
Fgfr4	T	C	13: 55,161,449	V433A	probably benign	Het
Gal3st1	A	T	11: 3,998,093	Q100L	possibly damaging	Het
Gfra2	T	C	14: 70,925,940	F221S	probably damaging	Het
Gm19965	G	A	1: 116,821,191	V201M		Het
Gm9573	G	A	17: 35,618,869	A1475V	unknown	Het
Gnb1l	A	T	16: 18,564,056	T282S	probably benign	Het
Gpr171	A	T	3: 59,097,726	N209K	probably benign	Het
Grasp	G	A	15: 101,231,538	S234N	probably damaging	Het
Greb1	G	A	12: 16,711,738	T547I	probably damaging	Het
Ifi214	A	T	1: 173,529,531	V2E	probably benign	Het
Ighv1-71	T	C	12: 115,742,647	M1V	probably null	Het
Itm2b	C	T	14: 73,368,345	G67D	probably damaging	Het
Kifc2	A	T	15: 76,660,704	Y13F	probably damaging	Het
Lamb1	T	A	12: 31,265,596	V59D	probably benign	Het
Lhx1	A	T	11: 84,521,877	D163E	probably damaging	Het
Lrrc1	A	T	9: 77,457,839	Y187N	probably benign	Het
Map3k1	C	A	13: 111,768,111	V380F	probably damaging	Het
Mapk11	T	C	15: 89,144,308	D283G	probably damaging	Het
Mccc2	G	T	13: 99,954,699	A430D	probably damaging	Het
Mest	A	G	6: 30,747,159	N340S	unknown	Het
Mms22l	T	C	4: 24,517,139	L340P	probably benign	Het
Mrnip	A	G	11: 50,196,981	Y110C	possibly damaging	Het
Mtmr4	A	G	11: 87,611,237	T706A	probably benign	Het
Ncstn	A	G	1: 172,072,806	F234S	probably benign	Het
Nrp1	T	C	8: 128,476,296		probably null	Het
Nup37	T	G	10: 88,174,494	C217G	probably damaging	Het
Olfr936	A	G	9: 39,047,398	L7P	unknown	Het
Pdzrn3	T	C	6: 101,151,245	N820S	probably benign	Het
Pgap1	A	T	1: 54,548,066	F117Y	possibly damaging	Het
Phip	A	T	9: 82,871,293	F1799L	possibly damaging	Het
Ppm1f	T	A	16: 16,910,955	F74I	probably benign	Het
Prpf8	C	A	11: 75,493,957	N775K	possibly damaging	Het
Ptdss2	T	C	7: 141,151,780	I167T	possibly damaging	Het
Ptpn18	G	A	1: 34,462,811		probably null	Het
Rbl2	C	A	8: 91,115,041	A955D	probably benign	Het
Rgl1	A	G	1: 152,544,395	S366P	possibly damaging	Het
Rit2	A	T	18: 31,243,168	M38K	possibly damaging	Het
Robo1	A	G	16: 73,004,520	M1011V	probably benign	Het
Senp6	A	T	9: 80,136,515	E809D	probably benign	Het
Stard3	G	A	11: 98,378,219		probably null	Het
Taar3	T	G	10: 23,950,400	Y281*	probably null	Het
Tacc2	G	T	7: 130,729,373	K352N	probably benign	Het
Tdpoz4	G	A	3: 93,796,848	V151I	not run	Het
Tenm2	A	G	11: 36,023,471	L2413P	probably damaging	Het
Tgm6	T	C	2: 130,141,190	V233A	probably damaging	Het
Tlx3	G	A	11: 33,203,514		probably benign	Het
Tmem94	G	T	11: 115,786,256	R118L	possibly damaging	Het
Trim23	C	A	13: 104,187,433	H133Q	probably damaging	Het
Unc80	A	T	1: 66,601,197	D1421V	probably damaging	Het
Vmn1r172	A	G	7: 23,660,623	N311S	unknown	Het
Vps25	T	A	11: 101,258,949	L153Q	probably damaging	Het
Wbp1l	G	T	19: 46,623,437		probably benign	Het
Ythdc2	A	G	18: 44,837,491	I291V	possibly damaging	Het
Zfp2	A	G	11: 50,900,743	C158R	probably damaging	Het
Zfp786	G	A	6: 47,819,995	P670S	probably damaging	Het
Zfp827	G	A	8: 79,189,813	R339H	possibly damaging	Het
Zmym6	C	T	4: 127,123,501	A1025V	possibly damaging	Het

Other mutations in Kif21a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00539:Kif21a	APN	15	90937301	missense	probably damaging	1.00
IGL01476:Kif21a	APN	15	90943864	missense	possibly damaging	0.66
IGL01617:Kif21a	APN	15	90995637	splice site	probably benign
IGL01736:Kif21a	APN	15	90959745	missense	possibly damaging	0.59
IGL01923:Kif21a	APN	15	90956430	missense	probably damaging	0.96
IGL01985:Kif21a	APN	15	90991767	missense	probably damaging	1.00
IGL02304:Kif21a	APN	15	90965535	missense	probably damaging	1.00
IGL02589:Kif21a	APN	15	90985286	missense	probably damaging	1.00
IGL03115:Kif21a	APN	15	90985395	missense	probably damaging	0.99
IGL03211:Kif21a	APN	15	90997963	missense	possibly damaging	0.73
IGL03372:Kif21a	APN	15	90956376	missense	probably benign	0.38
reflex	UTSW	15	90968358	missense	probably null	1.00
R0052:Kif21a	UTSW	15	90970857	missense	probably damaging	0.98
R0052:Kif21a	UTSW	15	90970857	missense	probably damaging	0.98
R0304:Kif21a	UTSW	15	90976521	splice site	probably null
R0378:Kif21a	UTSW	15	90969774	splice site	probably null
R0420:Kif21a	UTSW	15	90968054	unclassified	probably benign
R0536:Kif21a	UTSW	15	90959683	splice site	probably benign
R0826:Kif21a	UTSW	15	90997541	critical splice donor site	probably null
R0971:Kif21a	UTSW	15	90940581	missense	possibly damaging	0.46
R1052:Kif21a	UTSW	15	90935650	missense	probably benign	0.17
R1168:Kif21a	UTSW	15	90993753	missense	probably damaging	1.00
R1324:Kif21a	UTSW	15	90948322	critical splice donor site	probably null
R1471:Kif21a	UTSW	15	90956419	missense	probably benign	0.04
R1625:Kif21a	UTSW	15	90942175	missense	probably damaging	1.00
R1636:Kif21a	UTSW	15	90984805	splice site	probably benign
R1647:Kif21a	UTSW	15	90994367	missense	probably damaging	1.00
R1648:Kif21a	UTSW	15	90994367	missense	probably damaging	1.00
R1699:Kif21a	UTSW	15	90959743	missense	probably damaging	0.99
R1703:Kif21a	UTSW	15	90949047	splice site	probably null
R1795:Kif21a	UTSW	15	90972727	splice site	probably null
R1812:Kif21a	UTSW	15	90971766	missense	possibly damaging	0.63
R1959:Kif21a	UTSW	15	90970848	missense	probably damaging	0.99
R1960:Kif21a	UTSW	15	90970848	missense	probably damaging	0.99
R1961:Kif21a	UTSW	15	90970848	missense	probably damaging	0.99
R1996:Kif21a	UTSW	15	90994371	nonsense	probably null
R2230:Kif21a	UTSW	15	90985362	nonsense	probably null
R2231:Kif21a	UTSW	15	90985362	nonsense	probably null
R2232:Kif21a	UTSW	15	90985362	nonsense	probably null
R2424:Kif21a	UTSW	15	90971196	missense	probably damaging	1.00
R2429:Kif21a	UTSW	15	90998005	missense	probably damaging	1.00
R2513:Kif21a	UTSW	15	90994391	missense	possibly damaging	0.96
R2846:Kif21a	UTSW	15	90934464	missense	probably benign
R3027:Kif21a	UTSW	15	90972642	missense	probably damaging	0.99
R3624:Kif21a	UTSW	15	90965595	missense	probably damaging	0.99
R3820:Kif21a	UTSW	15	90968074	missense	probably benign	0.17
R3923:Kif21a	UTSW	15	90937294	missense	possibly damaging	0.46
R3962:Kif21a	UTSW	15	90985409	missense	probably damaging	1.00
R4355:Kif21a	UTSW	15	90970833	missense	probably benign	0.17
R4516:Kif21a	UTSW	15	90971142	missense	probably benign	0.38
R4530:Kif21a	UTSW	15	90968089	splice site	probably null
R4612:Kif21a	UTSW	15	90968223	splice site	probably null
R4674:Kif21a	UTSW	15	90940545	missense	possibly damaging	0.66
R4675:Kif21a	UTSW	15	90940545	missense	possibly damaging	0.66
R4698:Kif21a	UTSW	15	90956305	missense	possibly damaging	0.85
R4712:Kif21a	UTSW	15	90984755	missense	probably damaging	1.00
R4955:Kif21a	UTSW	15	90937190	missense	probably damaging	1.00
R4974:Kif21a	UTSW	15	90949010	missense	probably benign	0.16
R5034:Kif21a	UTSW	15	90968358	missense	probably null	1.00
R5165:Kif21a	UTSW	15	90956376	missense	probably benign	0.38
R5464:Kif21a	UTSW	15	90993855	missense	probably damaging	1.00
R5541:Kif21a	UTSW	15	90968113	missense	probably damaging	0.99
R5757:Kif21a	UTSW	15	90951345	missense	probably damaging	1.00
R5936:Kif21a	UTSW	15	90935647	missense	possibly damaging	0.95
R5976:Kif21a	UTSW	15	90935812	missense	probably damaging	1.00
R6074:Kif21a	UTSW	15	90980892	missense	probably benign
R6638:Kif21a	UTSW	15	90966407	missense	probably damaging	1.00
R6723:Kif21a	UTSW	15	90940446	missense	probably damaging	0.97
R6785:Kif21a	UTSW	15	90935730	missense	probably damaging	1.00
R6977:Kif21a	UTSW	15	90980837	missense	probably damaging	1.00
R7058:Kif21a	UTSW	15	90948903	splice site	probably null
R7147:Kif21a	UTSW	15	90980883	missense	probably benign	0.13
R7438:Kif21a	UTSW	15	90993796	missense	probably benign	0.37
R7593:Kif21a	UTSW	15	90943861	missense	probably benign	0.03
R7661:Kif21a	UTSW	15	90980919	missense	possibly damaging	0.89
R7891:Kif21a	UTSW	15	90956314	missense	probably damaging	1.00
R8137:Kif21a	UTSW	15	90968442	missense	probably benign
R8182:Kif21a	UTSW	15	90935761	missense	possibly damaging	0.77
R8303:Kif21a	UTSW	15	90971196	missense	probably damaging	0.99
R8388:Kif21a	UTSW	15	90959124	missense	possibly damaging	0.60
R8867:Kif21a	UTSW	15	90968179	missense	probably damaging	0.96
R8921:Kif21a	UTSW	15	90971727	missense	probably benign	0.04
R8984:Kif21a	UTSW	15	90956356	missense	probably benign	0.00
R9024:Kif21a	UTSW	15	90937196	nonsense	probably null
R9254:Kif21a	UTSW	15	90969827	missense	probably damaging	0.99
R9366:Kif21a	UTSW	15	90959748	missense	probably damaging	0.99
R9379:Kif21a	UTSW	15	90969827	missense	probably damaging	0.99
R9393:Kif21a	UTSW	15	90969778	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TATCTTTAAGACCCTGAGCATCC -3'
(R):5'- CCATCATTCTGTCTCGAATGTACTG -3'

Sequencing Primer
(F):5'- ACCATACTTCTAGCATCTGGGAG -3'
(R):5'- TTTGTTTGTTTGTTTTATAGCAACGG -3'

Posted On

2019-06-26