Incidental Mutation 'R7290:Kif21a'
ID566363
Institutional Source Beutler Lab
Gene Symbol Kif21a
Ensembl Gene ENSMUSG00000022629
Gene Namekinesin family member 21A
SynonymsN-5 kinesin
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7290 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location90933276-91049948 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 90967229 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 995 (C995*)
Ref Sequence ENSEMBL: ENSMUSP00000104911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067205] [ENSMUST00000088614] [ENSMUST00000100304] [ENSMUST00000109287] [ENSMUST00000109288] [ENSMUST00000229801]
Predicted Effect probably null
Transcript: ENSMUST00000067205
AA Change: C995*
SMART Domains Protein: ENSMUSP00000066911
Gene: ENSMUSG00000022629
AA Change: C995*

DomainStartEndE-ValueType
KISc 7 379 8.97e-163 SMART
Blast:KISc 469 513 9e-9 BLAST
low complexity region 514 525 N/A INTRINSIC
low complexity region 542 557 N/A INTRINSIC
low complexity region 571 585 N/A INTRINSIC
low complexity region 589 628 N/A INTRINSIC
low complexity region 700 713 N/A INTRINSIC
coiled coil region 924 1008 N/A INTRINSIC
coiled coil region 1043 1066 N/A INTRINSIC
low complexity region 1101 1112 N/A INTRINSIC
low complexity region 1222 1234 N/A INTRINSIC
low complexity region 1251 1271 N/A INTRINSIC
WD40 1290 1327 1.21e-7 SMART
WD40 1330 1368 7.28e-2 SMART
WD40 1394 1432 3.33e-1 SMART
WD40 1435 1477 7e-4 SMART
WD40 1485 1523 2.4e-1 SMART
WD40 1527 1566 1.48e-2 SMART
WD40 1569 1606 2.07e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000088614
AA Change: C1008*
SMART Domains Protein: ENSMUSP00000085985
Gene: ENSMUSG00000022629
AA Change: C1008*

DomainStartEndE-ValueType
KISc 7 379 8.97e-163 SMART
Blast:KISc 469 513 1e-8 BLAST
low complexity region 514 525 N/A INTRINSIC
low complexity region 542 564 N/A INTRINSIC
low complexity region 584 598 N/A INTRINSIC
low complexity region 602 641 N/A INTRINSIC
low complexity region 713 726 N/A INTRINSIC
coiled coil region 937 1021 N/A INTRINSIC
coiled coil region 1056 1079 N/A INTRINSIC
low complexity region 1114 1125 N/A INTRINSIC
low complexity region 1271 1283 N/A INTRINSIC
low complexity region 1300 1316 N/A INTRINSIC
WD40 1334 1371 1.21e-7 SMART
WD40 1374 1412 7.28e-2 SMART
WD40 1438 1476 3.33e-1 SMART
WD40 1479 1521 7e-4 SMART
WD40 1529 1567 2.4e-1 SMART
WD40 1571 1610 1.48e-2 SMART
WD40 1613 1650 2.07e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000100304
AA Change: C1008*
SMART Domains Protein: ENSMUSP00000097877
Gene: ENSMUSG00000022629
AA Change: C1008*

DomainStartEndE-ValueType
KISc 7 379 8.97e-163 SMART
Blast:KISc 469 513 1e-8 BLAST
low complexity region 514 525 N/A INTRINSIC
low complexity region 542 564 N/A INTRINSIC
low complexity region 584 598 N/A INTRINSIC
low complexity region 602 641 N/A INTRINSIC
low complexity region 713 726 N/A INTRINSIC
coiled coil region 937 1021 N/A INTRINSIC
coiled coil region 1056 1079 N/A INTRINSIC
low complexity region 1271 1283 N/A INTRINSIC
low complexity region 1300 1316 N/A INTRINSIC
WD40 1334 1371 1.21e-7 SMART
WD40 1374 1412 7.28e-2 SMART
WD40 1438 1476 3.33e-1 SMART
WD40 1479 1521 7e-4 SMART
WD40 1529 1567 2.4e-1 SMART
WD40 1571 1610 1.48e-2 SMART
WD40 1613 1650 2.07e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109287
AA Change: C995*
SMART Domains Protein: ENSMUSP00000104910
Gene: ENSMUSG00000022629
AA Change: C995*

DomainStartEndE-ValueType
KISc 7 379 8.97e-163 SMART
Blast:KISc 469 513 9e-9 BLAST
low complexity region 514 525 N/A INTRINSIC
low complexity region 542 557 N/A INTRINSIC
low complexity region 571 585 N/A INTRINSIC
low complexity region 589 628 N/A INTRINSIC
low complexity region 700 713 N/A INTRINSIC
coiled coil region 924 1008 N/A INTRINSIC
coiled coil region 1043 1066 N/A INTRINSIC
low complexity region 1101 1112 N/A INTRINSIC
WD40 1229 1266 1.21e-7 SMART
WD40 1269 1307 7.28e-2 SMART
WD40 1333 1371 3.33e-1 SMART
WD40 1374 1416 7e-4 SMART
WD40 1424 1462 2.4e-1 SMART
WD40 1466 1505 1.48e-2 SMART
WD40 1508 1545 2.07e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109288
AA Change: C995*
SMART Domains Protein: ENSMUSP00000104911
Gene: ENSMUSG00000022629
AA Change: C995*

DomainStartEndE-ValueType
KISc 7 379 8.97e-163 SMART
Blast:KISc 469 513 9e-9 BLAST
low complexity region 514 525 N/A INTRINSIC
low complexity region 542 557 N/A INTRINSIC
low complexity region 571 585 N/A INTRINSIC
low complexity region 589 628 N/A INTRINSIC
low complexity region 700 713 N/A INTRINSIC
coiled coil region 924 1008 N/A INTRINSIC
coiled coil region 1043 1066 N/A INTRINSIC
low complexity region 1205 1216 N/A INTRINSIC
WD40 1235 1272 1.21e-7 SMART
WD40 1275 1313 7.28e-2 SMART
WD40 1339 1377 3.33e-1 SMART
WD40 1380 1422 7e-4 SMART
WD40 1430 1468 2.4e-1 SMART
WD40 1472 1511 1.48e-2 SMART
WD40 1514 1551 2.07e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000229801
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the KIF4 subfamily of kinesin-like motor proteins. The encoded protein is characterized by an N-terminal motor domain a coiled-coil stalk domain and a C-terminal WD-40 repeat domain. This protein may be involved in microtubule dependent transport. Mutations in this gene are the cause of congenital fibrosis of extraocular muscles-1. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a T A 11: 110,030,888 M1447L probably benign Het
Adam30 G A 3: 98,162,941 V697I probably benign Het
Adamts12 A G 15: 11,277,366 N689D probably benign Het
Adamts15 T C 9: 30,902,610 K753R probably benign Het
Adra2a T C 19: 54,046,404 F64L probably damaging Het
Ankub1 A G 3: 57,672,924 L104P probably damaging Het
Arel1 A G 12: 84,941,945 V10A probably benign Het
Atad2 A T 15: 58,098,651 N1165K probably benign Het
Atp6v0d2 T A 4: 19,880,060 D279V probably benign Het
Cadps A T 14: 12,616,099 D310E probably damaging Het
Caskin2 T C 11: 115,804,789 I249V possibly damaging Het
Cdh23 T C 10: 60,376,841 N1598S probably benign Het
Cep250 A T 2: 155,992,762 Q2202H probably benign Het
Ces5a T A 8: 93,534,683 T35S probably damaging Het
Cnot11 G A 1: 39,539,939 W295* probably null Het
Cntnap5a G T 1: 116,221,889 W565L probably damaging Het
Dgka T C 10: 128,733,599 E148G probably damaging Het
Dnah14 G A 1: 181,628,174 D955N probably benign Het
Erbin G A 13: 103,862,326 T184I probably damaging Het
Fam208a T A 14: 27,438,653 I124N probably damaging Het
Fam20c G T 5: 138,807,554 G477W probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fgfr4 T C 13: 55,161,449 V433A probably benign Het
Gal3st1 A T 11: 3,998,093 Q100L possibly damaging Het
Gfra2 T C 14: 70,925,940 F221S probably damaging Het
Gm19965 G A 1: 116,821,191 V201M Het
Gm9573 G A 17: 35,618,869 A1475V unknown Het
Gnb1l A T 16: 18,564,056 T282S probably benign Het
Gpr171 A T 3: 59,097,726 N209K probably benign Het
Grasp G A 15: 101,231,538 S234N probably damaging Het
Greb1 G A 12: 16,711,738 T547I probably damaging Het
Ifi214 A T 1: 173,529,531 V2E probably benign Het
Ighv1-71 T C 12: 115,742,647 M1V probably null Het
Itm2b C T 14: 73,368,345 G67D probably damaging Het
Kifc2 A T 15: 76,660,704 Y13F probably damaging Het
Lamb1 T A 12: 31,265,596 V59D probably benign Het
Lhx1 A T 11: 84,521,877 D163E probably damaging Het
Lrrc1 A T 9: 77,457,839 Y187N probably benign Het
Map3k1 C A 13: 111,768,111 V380F probably damaging Het
Mapk11 T C 15: 89,144,308 D283G probably damaging Het
Mccc2 G T 13: 99,954,699 A430D probably damaging Het
Mest A G 6: 30,747,159 N340S unknown Het
Mms22l T C 4: 24,517,139 L340P probably benign Het
Mrnip A G 11: 50,196,981 Y110C possibly damaging Het
Mtmr4 A G 11: 87,611,237 T706A probably benign Het
Ncstn A G 1: 172,072,806 F234S probably benign Het
Nrp1 T C 8: 128,476,296 probably null Het
Nup37 T G 10: 88,174,494 C217G probably damaging Het
Olfr936 A G 9: 39,047,398 L7P unknown Het
Pdzrn3 T C 6: 101,151,245 N820S probably benign Het
Pgap1 A T 1: 54,548,066 F117Y possibly damaging Het
Phip A T 9: 82,871,293 F1799L possibly damaging Het
Ppm1f T A 16: 16,910,955 F74I probably benign Het
Prpf8 C A 11: 75,493,957 N775K possibly damaging Het
Ptdss2 T C 7: 141,151,780 I167T possibly damaging Het
Ptpn18 G A 1: 34,462,811 probably null Het
Rbl2 C A 8: 91,115,041 A955D probably benign Het
Rgl1 A G 1: 152,544,395 S366P possibly damaging Het
Rit2 A T 18: 31,243,168 M38K possibly damaging Het
Robo1 A G 16: 73,004,520 M1011V probably benign Het
Senp6 A T 9: 80,136,515 E809D probably benign Het
Stard3 G A 11: 98,378,219 probably null Het
Taar3 T G 10: 23,950,400 Y281* probably null Het
Tacc2 G T 7: 130,729,373 K352N probably benign Het
Tdpoz4 G A 3: 93,796,848 V151I not run Het
Tenm2 A G 11: 36,023,471 L2413P probably damaging Het
Tgm6 T C 2: 130,141,190 V233A probably damaging Het
Tlx3 G A 11: 33,203,514 probably benign Het
Tmem94 G T 11: 115,786,256 R118L possibly damaging Het
Trim23 C A 13: 104,187,433 H133Q probably damaging Het
Unc80 A T 1: 66,601,197 D1421V probably damaging Het
Vmn1r172 A G 7: 23,660,623 N311S unknown Het
Vps25 T A 11: 101,258,949 L153Q probably damaging Het
Wbp1l G T 19: 46,623,437 probably benign Het
Ythdc2 A G 18: 44,837,491 I291V possibly damaging Het
Zfp2 A G 11: 50,900,743 C158R probably damaging Het
Zfp786 G A 6: 47,819,995 P670S probably damaging Het
Zfp827 G A 8: 79,189,813 R339H possibly damaging Het
Zmym6 C T 4: 127,123,501 A1025V possibly damaging Het
Other mutations in Kif21a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Kif21a APN 15 90937301 missense probably damaging 1.00
IGL01476:Kif21a APN 15 90943864 missense possibly damaging 0.66
IGL01617:Kif21a APN 15 90995637 splice site probably benign
IGL01736:Kif21a APN 15 90959745 missense possibly damaging 0.59
IGL01923:Kif21a APN 15 90956430 missense probably damaging 0.96
IGL01985:Kif21a APN 15 90991767 missense probably damaging 1.00
IGL02304:Kif21a APN 15 90965535 missense probably damaging 1.00
IGL02589:Kif21a APN 15 90985286 missense probably damaging 1.00
IGL03115:Kif21a APN 15 90985395 missense probably damaging 0.99
IGL03211:Kif21a APN 15 90997963 missense possibly damaging 0.73
IGL03372:Kif21a APN 15 90956376 missense probably benign 0.38
reflex UTSW 15 90968358 missense probably null 1.00
R0052:Kif21a UTSW 15 90970857 missense probably damaging 0.98
R0052:Kif21a UTSW 15 90970857 missense probably damaging 0.98
R0304:Kif21a UTSW 15 90976521 splice site probably null
R0378:Kif21a UTSW 15 90969774 splice site probably null
R0420:Kif21a UTSW 15 90968054 unclassified probably benign
R0536:Kif21a UTSW 15 90959683 splice site probably benign
R0826:Kif21a UTSW 15 90997541 critical splice donor site probably null
R0971:Kif21a UTSW 15 90940581 missense possibly damaging 0.46
R1052:Kif21a UTSW 15 90935650 missense probably benign 0.17
R1168:Kif21a UTSW 15 90993753 missense probably damaging 1.00
R1324:Kif21a UTSW 15 90948322 critical splice donor site probably null
R1471:Kif21a UTSW 15 90956419 missense probably benign 0.04
R1625:Kif21a UTSW 15 90942175 missense probably damaging 1.00
R1636:Kif21a UTSW 15 90984805 splice site probably benign
R1647:Kif21a UTSW 15 90994367 missense probably damaging 1.00
R1648:Kif21a UTSW 15 90994367 missense probably damaging 1.00
R1699:Kif21a UTSW 15 90959743 missense probably damaging 0.99
R1703:Kif21a UTSW 15 90949047 intron probably null
R1795:Kif21a UTSW 15 90972727 splice site probably null
R1812:Kif21a UTSW 15 90971766 missense possibly damaging 0.63
R1959:Kif21a UTSW 15 90970848 missense probably damaging 0.99
R1960:Kif21a UTSW 15 90970848 missense probably damaging 0.99
R1961:Kif21a UTSW 15 90970848 missense probably damaging 0.99
R1996:Kif21a UTSW 15 90994371 nonsense probably null
R2230:Kif21a UTSW 15 90985362 nonsense probably null
R2231:Kif21a UTSW 15 90985362 nonsense probably null
R2232:Kif21a UTSW 15 90985362 nonsense probably null
R2424:Kif21a UTSW 15 90971196 missense probably damaging 1.00
R2429:Kif21a UTSW 15 90998005 missense probably damaging 1.00
R2513:Kif21a UTSW 15 90994391 missense possibly damaging 0.96
R2846:Kif21a UTSW 15 90934464 missense probably benign
R3027:Kif21a UTSW 15 90972642 missense probably damaging 0.99
R3624:Kif21a UTSW 15 90965595 missense probably damaging 0.99
R3820:Kif21a UTSW 15 90968074 missense probably benign 0.17
R3923:Kif21a UTSW 15 90937294 missense possibly damaging 0.46
R3962:Kif21a UTSW 15 90985409 missense probably damaging 1.00
R4355:Kif21a UTSW 15 90970833 missense probably benign 0.17
R4516:Kif21a UTSW 15 90971142 missense probably benign 0.38
R4530:Kif21a UTSW 15 90968089 unclassified probably null
R4612:Kif21a UTSW 15 90968223 unclassified probably null
R4674:Kif21a UTSW 15 90940545 missense possibly damaging 0.66
R4675:Kif21a UTSW 15 90940545 missense possibly damaging 0.66
R4698:Kif21a UTSW 15 90956305 missense possibly damaging 0.85
R4712:Kif21a UTSW 15 90984755 missense probably damaging 1.00
R4955:Kif21a UTSW 15 90937190 missense probably damaging 1.00
R4974:Kif21a UTSW 15 90949010 missense probably benign 0.16
R5034:Kif21a UTSW 15 90968358 missense probably null 1.00
R5165:Kif21a UTSW 15 90956376 missense probably benign 0.38
R5464:Kif21a UTSW 15 90993855 missense probably damaging 1.00
R5541:Kif21a UTSW 15 90968113 missense probably damaging 0.99
R5757:Kif21a UTSW 15 90951345 missense probably damaging 1.00
R5936:Kif21a UTSW 15 90935647 missense possibly damaging 0.95
R5976:Kif21a UTSW 15 90935812 missense probably damaging 1.00
R6074:Kif21a UTSW 15 90980892 missense probably benign
R6638:Kif21a UTSW 15 90966407 missense probably damaging 1.00
R6723:Kif21a UTSW 15 90940446 missense probably damaging 0.97
R6785:Kif21a UTSW 15 90935730 missense probably damaging 1.00
R6977:Kif21a UTSW 15 90980837 missense probably damaging 1.00
R7058:Kif21a UTSW 15 90948903 intron probably null
R7147:Kif21a UTSW 15 90980883 missense probably benign 0.13
R7438:Kif21a UTSW 15 90993796 missense probably benign 0.37
R7593:Kif21a UTSW 15 90943861 missense probably benign 0.03
R7661:Kif21a UTSW 15 90980919 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TATCTTTAAGACCCTGAGCATCC -3'
(R):5'- CCATCATTCTGTCTCGAATGTACTG -3'

Sequencing Primer
(F):5'- ACCATACTTCTAGCATCTGGGAG -3'
(R):5'- TTTGTTTGTTTGTTTTATAGCAACGG -3'
Posted On2019-06-26