Incidental Mutation 'R7291:Hecw2'
ID566373
Institutional Source Beutler Lab
Gene Symbol Hecw2
Ensembl Gene ENSMUSG00000042807
Gene NameHECT, C2 and WW domain containing E3 ubiquitin protein ligase 2
SynonymsA730039N16Rik, Nedl2, D030049F17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.545) question?
Stock #R7291 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location53806876-54195168 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 53914594 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 831 (Y831H)
Ref Sequence ENSEMBL: ENSMUSP00000084942 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087659] [ENSMUST00000120904]
Predicted Effect probably damaging
Transcript: ENSMUST00000087659
AA Change: Y831H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000084942
Gene: ENSMUSG00000042807
AA Change: Y831H

DomainStartEndE-ValueType
Pfam:HECW_N 45 164 4.6e-62 PFAM
low complexity region 165 178 N/A INTRINSIC
C2 186 297 2.19e-12 SMART
low complexity region 577 596 N/A INTRINSIC
low complexity region 716 735 N/A INTRINSIC
low complexity region 746 755 N/A INTRINSIC
low complexity region 769 786 N/A INTRINSIC
WW 814 846 1.21e-11 SMART
coiled coil region 853 880 N/A INTRINSIC
low complexity region 913 925 N/A INTRINSIC
WW 992 1024 2.12e-7 SMART
Blast:HECTc 1111 1183 2e-23 BLAST
HECTc 1241 1578 8.02e-183 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120904
AA Change: Y831H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113283
Gene: ENSMUSG00000042807
AA Change: Y831H

DomainStartEndE-ValueType
PDB:2LFE|A 42 162 6e-80 PDB
low complexity region 165 178 N/A INTRINSIC
C2 186 297 2.19e-12 SMART
low complexity region 577 596 N/A INTRINSIC
low complexity region 716 735 N/A INTRINSIC
low complexity region 746 755 N/A INTRINSIC
low complexity region 769 786 N/A INTRINSIC
WW 814 846 1.21e-11 SMART
coiled coil region 853 880 N/A INTRINSIC
low complexity region 913 925 N/A INTRINSIC
WW 992 1024 2.12e-7 SMART
Blast:HECTc 1111 1183 2e-23 BLAST
HECTc 1241 1578 8.02e-183 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of E3 ubiquitin ligases which plays an important role in the proliferation, migration and differentiation of neural crest cells as a regulator of glial cell line-derived neurotrophic factor (GDNF)/Ret signaling. This gene also plays an important role in angiogenesis through stabilization of endothelial cell-to-cell junctions as a regulator of angiomotin-like 1 stability. The encoded protein contains an N-terminal calcium/lipid-binding (C2) domain involved in membrane targeting, two-four WW domains responsible for cellular localization and substrate recognition, and a C-terminal homologous with E6-associated protein C-terminus (HECT) catalytic domain. Naturally occurring mutations in this gene are associated with neurodevelopmental delay, hypotonia, and epilepsy. The decreased expression of this gene in the aganglionic colon is associated with Hirschsprung's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430069I07Rik T C 15: 34,355,553 E51G possibly damaging Het
9530053A07Rik A C 7: 28,140,220 D486A probably benign Het
Abca14 C A 7: 120,289,609 C1259* probably null Het
Ablim1 T C 19: 57,215,908 E17G probably benign Het
Acsf3 G A 8: 122,813,577 V505I probably benign Het
Actn1 T C 12: 80,174,085 M650V probably benign Het
Adamts4 G A 1: 171,256,528 V525I probably benign Het
Adh1 T C 3: 138,282,808 Y181H probably damaging Het
Alpl G A 4: 137,752,698 R168W probably damaging Het
Ate1 T G 7: 130,519,931 K11Q probably benign Het
Atpaf1 T A 4: 115,811,091 F314L probably damaging Het
Baiap3 T A 17: 25,244,317 D1004V probably damaging Het
Bpifb9a C T 2: 154,267,696 T504M probably damaging Het
C1s2 T A 6: 124,625,384 I623F probably benign Het
Card11 T C 5: 140,901,070 D308G probably damaging Het
Cul9 C T 17: 46,540,433 V354I probably benign Het
Dnah1 A T 14: 31,298,705 F1236I probably damaging Het
Dync2h1 T A 9: 6,929,590 I4266F possibly damaging Het
Ear10 A T 14: 43,922,920 V150D probably damaging Het
Elfn2 C T 15: 78,672,983 A455T probably benign Het
Erp44 A G 4: 48,208,792 Y223H probably damaging Het
Fam110b T A 4: 5,798,895 H104Q probably benign Het
Fcgbp A G 7: 28,101,392 N1288D probably benign Het
Fcrl1 T C 3: 87,385,781 probably null Het
Fmo2 G T 1: 162,887,702 P117Q probably benign Het
Fsip2 A G 2: 82,980,519 K2394R possibly damaging Het
Gab1 T G 8: 80,800,151 K106T probably damaging Het
Gatad2b T C 3: 90,351,414 V248A probably damaging Het
Gemin6 T C 17: 80,227,775 S55P possibly damaging Het
Gfm2 G A 13: 97,175,024 V701I probably benign Het
Gm3250 T C 10: 77,782,227 T106A unknown Het
Gm7356 T C 17: 14,001,581 N62S probably benign Het
Gsdmc4 T C 15: 63,902,840 T31A possibly damaging Het
H2-M10.1 T A 17: 36,325,729 D61V probably damaging Het
Heatr5a A G 12: 51,925,339 L716S probably damaging Het
Ifi202b C T 1: 173,974,815 S151N probably benign Het
Il15ra C T 2: 11,718,381 T72I probably damaging Het
Ints1 A G 5: 139,765,074 L858P probably damaging Het
Kat2a C T 11: 100,710,900 V230I possibly damaging Het
Kcnq2 A T 2: 181,088,379 I498N possibly damaging Het
Kif26b C T 1: 178,679,046 T229I possibly damaging Het
Ly75 T A 2: 60,329,993 I957F probably damaging Het
Map3k12 T A 15: 102,502,166 R459W probably damaging Het
Mia2 T A 12: 59,158,369 probably null Het
Mrgprf A G 7: 145,307,469 I53V unknown Het
Mttp A G 3: 138,091,203 L846P probably damaging Het
Myrip C T 9: 120,417,141 L112F probably damaging Het
Nav1 A G 1: 135,465,859 F1047S probably damaging Het
Nfkbib T C 7: 28,759,203 D327G possibly damaging Het
Notch1 C T 2: 26,476,375 V776I probably benign Het
Obsl1 G T 1: 75,489,517 D1522E probably damaging Het
Olfr1464-ps1 A T 19: 13,282,153 F302I unknown Het
Olfr605 T A 7: 103,442,788 M112L probably benign Het
Olfr823 T C 10: 130,112,224 K189E probably benign Het
Olfr859 T C 9: 19,808,648 M110T possibly damaging Het
Pde7a T C 3: 19,227,674 N471D probably benign Het
Pla2r1 T C 2: 60,530,435 H203R probably benign Het
Plch2 C A 4: 154,998,472 C573F probably damaging Het
Polr1a G A 6: 71,941,456 R666Q probably benign Het
Prepl T C 17: 85,081,240 N145S probably benign Het
Psen2 C T 1: 180,238,956 V139M probably benign Het
Ptgdr A T 14: 44,859,192 M21K possibly damaging Het
Rapgef6 T C 11: 54,691,239 W1331R probably benign Het
Rp1l1 G A 14: 64,032,298 G1778S probably benign Het
Rrbp1 A T 2: 143,969,462 M824K probably benign Het
Sel1l T C 12: 91,848,965 T23A probably benign Het
Sele A G 1: 164,053,868 S515G possibly damaging Het
Slc22a23 T C 13: 34,197,839 N421D probably damaging Het
Slc35f3 T G 8: 126,394,558 L386R probably benign Het
Stab2 G A 10: 86,946,220 S699L probably damaging Het
Synrg A T 11: 84,009,381 L726F probably damaging Het
Syt3 G A 7: 44,395,919 V528M probably damaging Het
Szt2 A G 4: 118,391,249 I655T probably damaging Het
Tbr1 T C 2: 61,812,256 S622P probably damaging Het
Tex36 C T 7: 133,587,223 G207S probably benign Het
Trav5n-4 G A 14: 53,312,942 W13* probably null Het
Trdn A T 10: 33,437,736 E500V probably null Het
Ugt2b38 A T 5: 87,411,895 N379K probably damaging Het
Unc13d T C 11: 116,074,050 R248G possibly damaging Het
Vmn1r195 C T 13: 22,278,749 L130F probably damaging Het
Vmn2r110 T C 17: 20,574,209 I733V probably benign Het
Zfp870 T A 17: 32,883,854 N167I probably damaging Het
Zmynd10 A T 9: 107,549,304 M179L probably benign Het
Other mutations in Hecw2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Hecw2 APN 1 53830737 missense probably damaging 1.00
IGL00338:Hecw2 APN 1 53827881 splice site probably benign
IGL00530:Hecw2 APN 1 53853280 missense probably damaging 1.00
IGL01343:Hecw2 APN 1 53826976 missense probably damaging 0.96
IGL01503:Hecw2 APN 1 53826961 missense probably damaging 1.00
IGL01989:Hecw2 APN 1 53840792 missense probably damaging 1.00
IGL02016:Hecw2 APN 1 53831543 missense possibly damaging 0.73
IGL02052:Hecw2 APN 1 53926511 missense probably benign
IGL02085:Hecw2 APN 1 53942802 critical splice acceptor site probably null
IGL02302:Hecw2 APN 1 53933248 missense probably damaging 1.00
IGL02310:Hecw2 APN 1 53923916 missense probably null 0.38
IGL02388:Hecw2 APN 1 53925699 missense probably benign 0.17
IGL02499:Hecw2 APN 1 53926488 missense probably benign
IGL02695:Hecw2 APN 1 53926209 missense possibly damaging 0.94
IGL02732:Hecw2 APN 1 53926688 splice site probably benign
IGL03100:Hecw2 APN 1 53831656 missense probably damaging 1.00
IGL03175:Hecw2 APN 1 53926257 missense possibly damaging 0.51
IGL03253:Hecw2 APN 1 53832716 missense possibly damaging 0.85
IGL03356:Hecw2 APN 1 53927058 splice site probably benign
Memoriam UTSW 1 53926056 missense probably benign
recollect UTSW 1 53904422 missense possibly damaging 0.88
ANU74:Hecw2 UTSW 1 53925694 missense probably benign 0.01
R0077:Hecw2 UTSW 1 53868831 splice site probably benign
R0133:Hecw2 UTSW 1 53830740 missense probably damaging 1.00
R0268:Hecw2 UTSW 1 53926698 splice site probably benign
R1303:Hecw2 UTSW 1 54040393 missense probably benign 0.00
R1460:Hecw2 UTSW 1 53813245 missense probably damaging 0.96
R1524:Hecw2 UTSW 1 53851618 missense probably damaging 1.00
R1533:Hecw2 UTSW 1 53926545 splice site probably null
R1828:Hecw2 UTSW 1 53926023 missense probably benign
R2170:Hecw2 UTSW 1 53942797 missense probably damaging 0.99
R2338:Hecw2 UTSW 1 53904422 missense possibly damaging 0.88
R3016:Hecw2 UTSW 1 53830680 missense probably damaging 1.00
R3872:Hecw2 UTSW 1 53832757 splice site probably benign
R3892:Hecw2 UTSW 1 53926121 missense probably benign 0.01
R4086:Hecw2 UTSW 1 53831656 missense probably damaging 1.00
R4247:Hecw2 UTSW 1 53832645 missense probably damaging 1.00
R4248:Hecw2 UTSW 1 53832645 missense probably damaging 1.00
R4249:Hecw2 UTSW 1 53832645 missense probably damaging 1.00
R4545:Hecw2 UTSW 1 53813222 makesense probably null
R4805:Hecw2 UTSW 1 53840859 missense probably damaging 1.00
R4834:Hecw2 UTSW 1 53830752 missense probably damaging 1.00
R4884:Hecw2 UTSW 1 53950841 missense probably benign 0.03
R4983:Hecw2 UTSW 1 53832671 missense probably benign 0.42
R5168:Hecw2 UTSW 1 53913300 missense probably damaging 1.00
R5482:Hecw2 UTSW 1 53926201 missense probably benign 0.09
R5549:Hecw2 UTSW 1 53925691 missense possibly damaging 0.91
R5623:Hecw2 UTSW 1 53832623 missense probably null 1.00
R5740:Hecw2 UTSW 1 53887603 missense probably benign 0.12
R5919:Hecw2 UTSW 1 53937090 missense probably damaging 0.99
R6058:Hecw2 UTSW 1 53923976 missense possibly damaging 0.67
R6460:Hecw2 UTSW 1 53868833 splice site probably null
R6875:Hecw2 UTSW 1 53937132 missense probably benign 0.01
R7097:Hecw2 UTSW 1 53865124 missense possibly damaging 0.88
R7131:Hecw2 UTSW 1 53865121 missense probably damaging 1.00
R7401:Hecw2 UTSW 1 53904343 missense probably damaging 1.00
R7482:Hecw2 UTSW 1 54040470 missense probably damaging 0.99
R7501:Hecw2 UTSW 1 53913872 critical splice acceptor site probably null
R7520:Hecw2 UTSW 1 53926056 missense probably benign
R7611:Hecw2 UTSW 1 53913300 missense probably damaging 1.00
R8184:Hecw2 UTSW 1 54040387 missense probably benign 0.37
R8286:Hecw2 UTSW 1 53840769 missense probably damaging 1.00
R8300:Hecw2 UTSW 1 53887616 missense probably null 0.07
R8362:Hecw2 UTSW 1 54040491 start codon destroyed probably null 0.51
Z1177:Hecw2 UTSW 1 53923943 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AAACGCCCAGTCGTCTATGC -3'
(R):5'- CAACAGTTTCCCAAGTGGACTG -3'

Sequencing Primer
(F):5'- AGTCGTCTATGCTGCACACAC -3'
(R):5'- CTGGGGAGGAAGCTAGGCTAC -3'
Posted On2019-06-26