Mutagenetix > Incidental Mutation

Incidental Mutation 'R7291:Nav1'

566375

Institutional Source

Beutler Lab

Gene Symbol

Nav1

Ensembl Gene

ENSMUSG00000009418

Gene Name

neuron navigator 1

Synonyms

steerin-1, C230080M11Rik, unc53H1, 9930003A20Rik, POMFIL3

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.932) question?

Stock #

R7291 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

135434580-135607295 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 135465859 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 1047 (F1047S)

Ref Sequence

ENSEMBL: ENSMUSP00000043803 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040599] [ENSMUST00000067414] [ENSMUST00000190298]

AlphaFold

Q8CH77

Predicted Effect

probably damaging
Transcript: ENSMUST00000040599
AA Change: F1047S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000043803
Gene: ENSMUSG00000009418
AA Change: F1047S

Domain	Start	End	E-Value	Type
low complexity region	16	33	N/A	INTRINSIC
low complexity region	48	65	N/A	INTRINSIC
low complexity region	119	132	N/A	INTRINSIC
low complexity region	303	318	N/A	INTRINSIC
low complexity region	414	428	N/A	INTRINSIC
low complexity region	436	456	N/A	INTRINSIC
low complexity region	739	749	N/A	INTRINSIC
low complexity region	807	818	N/A	INTRINSIC
low complexity region	892	913	N/A	INTRINSIC
low complexity region	975	989	N/A	INTRINSIC
coiled coil region	1070	1105	N/A	INTRINSIC
low complexity region	1179	1210	N/A	INTRINSIC
low complexity region	1260	1281	N/A	INTRINSIC
low complexity region	1296	1304	N/A	INTRINSIC
coiled coil region	1328	1360	N/A	INTRINSIC
AAA	1548	1702	3.16e-5	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000067414
AA Change: F1047S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000067241
Gene: ENSMUSG00000009418
AA Change: F1047S

Domain	Start	End	E-Value	Type
low complexity region	16	33	N/A	INTRINSIC
low complexity region	48	65	N/A	INTRINSIC
low complexity region	119	132	N/A	INTRINSIC
low complexity region	303	318	N/A	INTRINSIC
low complexity region	414	428	N/A	INTRINSIC
low complexity region	436	456	N/A	INTRINSIC
low complexity region	739	749	N/A	INTRINSIC
low complexity region	807	818	N/A	INTRINSIC
low complexity region	892	913	N/A	INTRINSIC
low complexity region	975	989	N/A	INTRINSIC
coiled coil region	1070	1105	N/A	INTRINSIC
low complexity region	1179	1210	N/A	INTRINSIC
low complexity region	1260	1281	N/A	INTRINSIC
low complexity region	1296	1304	N/A	INTRINSIC
coiled coil region	1328	1360	N/A	INTRINSIC
AAA	1548	1702	3.16e-5	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000189252
AA Change: F61S

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

Predicted Effect

probably benign
Transcript: ENSMUST00000190298

SMART Domains

Protein: ENSMUSP00000140322
Gene: ENSMUSG00000009418

Domain	Start	End	E-Value	Type
low complexity region	16	33	N/A	INTRINSIC
low complexity region	48	65	N/A	INTRINSIC
low complexity region	119	132	N/A	INTRINSIC
low complexity region	303	318	N/A	INTRINSIC
low complexity region	414	428	N/A	INTRINSIC
low complexity region	436	456	N/A	INTRINSIC
low complexity region	739	749	N/A	INTRINSIC
low complexity region	807	818	N/A	INTRINSIC
low complexity region	892	913	N/A	INTRINSIC
low complexity region	975	989	N/A	INTRINSIC
coiled coil region	1013	1048	N/A	INTRINSIC
low complexity region	1122	1153	N/A	INTRINSIC
low complexity region	1200	1221	N/A	INTRINSIC
low complexity region	1236	1244	N/A	INTRINSIC
coiled coil region	1268	1300	N/A	INTRINSIC
AAA	1488	1642	3.16e-5	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the neuron navigator family and is expressed predominantly in the nervous system. The encoded protein contains coiled-coil domains and a conserved AAA domain characteristic for ATPases associated with a variety of cellular activities. This gene is similar to unc-53, a Caenorhabditis elegans gene involved in axon guidance. The exact function of this gene is not known, but it is thought to play a role in in neuronal development and regeneration. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2009]

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9430069I07Rik	T	C	15: 34,355,553	E51G	possibly damaging	Het
9530053A07Rik	A	C	7: 28,140,220	D486A	probably benign	Het
Abca14	C	A	7: 120,289,609	C1259*	probably null	Het
Ablim1	T	C	19: 57,215,908	E17G	probably benign	Het
Acsf3	G	A	8: 122,813,577	V505I	probably benign	Het
Actn1	T	C	12: 80,174,085	M650V	probably benign	Het
Adamts4	G	A	1: 171,256,528	V525I	probably benign	Het
Adh1	T	C	3: 138,282,808	Y181H	probably damaging	Het
Alpl	G	A	4: 137,752,698	R168W	probably damaging	Het
Ate1	T	G	7: 130,519,931	K11Q	probably benign	Het
Atpaf1	T	A	4: 115,811,091	F314L	probably damaging	Het
Baiap3	T	A	17: 25,244,317	D1004V	probably damaging	Het
Bpifb9a	C	T	2: 154,267,696	T504M	probably damaging	Het
C1s2	T	A	6: 124,625,384	I623F	probably benign	Het
Card11	T	C	5: 140,901,070	D308G	probably damaging	Het
Cul9	C	T	17: 46,540,433	V354I	probably benign	Het
Dnah1	A	T	14: 31,298,705	F1236I	probably damaging	Het
Dync2h1	T	A	9: 6,929,590	I4266F	possibly damaging	Het
Ear10	A	T	14: 43,922,920	V150D	probably damaging	Het
Elfn2	C	T	15: 78,672,983	A455T	probably benign	Het
Erp44	A	G	4: 48,208,792	Y223H	probably damaging	Het
Fam110b	T	A	4: 5,798,895	H104Q	probably benign	Het
Fcgbp	A	G	7: 28,101,392	N1288D	probably benign	Het
Fcrl1	T	C	3: 87,385,781		probably null	Het
Fmo2	G	T	1: 162,887,702	P117Q	probably benign	Het
Fsip2	A	G	2: 82,980,519	K2394R	possibly damaging	Het
Gab1	T	G	8: 80,800,151	K106T	probably damaging	Het
Gatad2b	T	C	3: 90,351,414	V248A	probably damaging	Het
Gemin6	T	C	17: 80,227,775	S55P	possibly damaging	Het
Gfm2	G	A	13: 97,175,024	V701I	probably benign	Het
Gm3250	T	C	10: 77,782,227	T106A	unknown	Het
Gm7356	T	C	17: 14,001,581	N62S	probably benign	Het
Gsdmc4	T	C	15: 63,902,840	T31A	possibly damaging	Het
H2-M10.1	T	A	17: 36,325,729	D61V	probably damaging	Het
Heatr5a	A	G	12: 51,925,339	L716S	probably damaging	Het
Hecw2	A	G	1: 53,914,594	Y831H	probably damaging	Het
Ifi202b	C	T	1: 173,974,815	S151N	probably benign	Het
Il15ra	C	T	2: 11,718,381	T72I	probably damaging	Het
Ints1	A	G	5: 139,765,074	L858P	probably damaging	Het
Kat2a	C	T	11: 100,710,900	V230I	possibly damaging	Het
Kcnq2	A	T	2: 181,088,379	I498N	possibly damaging	Het
Kif26b	C	T	1: 178,679,046	T229I	possibly damaging	Het
Ly75	T	A	2: 60,329,993	I957F	probably damaging	Het
Map3k12	T	A	15: 102,502,166	R459W	probably damaging	Het
Mia2	T	A	12: 59,158,369		probably null	Het
Mrgprf	A	G	7: 145,307,469	I53V	unknown	Het
Mttp	A	G	3: 138,091,203	L846P	probably damaging	Het
Myrip	C	T	9: 120,417,141	L112F	probably damaging	Het
Nfkbib	T	C	7: 28,759,203	D327G	possibly damaging	Het
Notch1	C	T	2: 26,476,375	V776I	probably benign	Het
Obsl1	G	T	1: 75,489,517	D1522E	probably damaging	Het
Olfr1464-ps1	A	T	19: 13,282,153	F302I	unknown	Het
Olfr605	T	A	7: 103,442,788	M112L	probably benign	Het
Olfr823	T	C	10: 130,112,224	K189E	probably benign	Het
Olfr859	T	C	9: 19,808,648	M110T	possibly damaging	Het
Pde7a	T	C	3: 19,227,674	N471D	probably benign	Het
Pla2r1	T	C	2: 60,530,435	H203R	probably benign	Het
Plch2	C	A	4: 154,998,472	C573F	probably damaging	Het
Polr1a	G	A	6: 71,941,456	R666Q	probably benign	Het
Prepl	T	C	17: 85,081,240	N145S	probably benign	Het
Psen2	C	T	1: 180,238,956	V139M	probably benign	Het
Ptgdr	A	T	14: 44,859,192	M21K	possibly damaging	Het
Rapgef6	T	C	11: 54,691,239	W1331R	probably benign	Het
Rp1l1	G	A	14: 64,032,298	G1778S	probably benign	Het
Rrbp1	A	T	2: 143,969,462	M824K	probably benign	Het
Sel1l	T	C	12: 91,848,965	T23A	probably benign	Het
Sele	A	G	1: 164,053,868	S515G	possibly damaging	Het
Slc22a23	T	C	13: 34,197,839	N421D	probably damaging	Het
Slc35f3	T	G	8: 126,394,558	L386R	probably benign	Het
Stab2	G	A	10: 86,946,220	S699L	probably damaging	Het
Synrg	A	T	11: 84,009,381	L726F	probably damaging	Het
Syt3	G	A	7: 44,395,919	V528M	probably damaging	Het
Szt2	A	G	4: 118,391,249	I655T	probably damaging	Het
Tbr1	T	C	2: 61,812,256	S622P	probably damaging	Het
Tex36	C	T	7: 133,587,223	G207S	probably benign	Het
Trav5n-4	G	A	14: 53,312,942	W13*	probably null	Het
Trdn	A	T	10: 33,437,736	E500V	probably null	Het
Ugt2b38	A	T	5: 87,411,895	N379K	probably damaging	Het
Unc13d	T	C	11: 116,074,050	R248G	possibly damaging	Het
Vmn1r195	C	T	13: 22,278,749	L130F	probably damaging	Het
Vmn2r110	T	C	17: 20,574,209	I733V	probably benign	Het
Zfp870	T	A	17: 32,883,854	N167I	probably damaging	Het
Zmynd10	A	T	9: 107,549,304	M179L	probably benign	Het

Other mutations in Nav1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01061:Nav1	APN	1	135450630	missense	probably damaging	1.00
IGL01455:Nav1	APN	1	135469635	missense	probably benign	0.44
IGL01650:Nav1	APN	1	135454760	missense	probably damaging	1.00
IGL01872:Nav1	APN	1	135454076	missense	probably damaging	1.00
IGL01967:Nav1	APN	1	135537245	missense	probably damaging	1.00
IGL02167:Nav1	APN	1	135470961	missense	probably damaging	1.00
IGL02278:Nav1	APN	1	135463714	splice site	probably benign
IGL02343:Nav1	APN	1	135454752	nonsense	probably null
IGL02378:Nav1	APN	1	135469978	missense	probably benign	0.02
IGL02554:Nav1	APN	1	135584913	synonymous	silent
IGL03148:Nav1	APN	1	135470024	missense	possibly damaging	0.94
IGL03286:Nav1	APN	1	135454536	missense	probably benign
IGL03372:Nav1	APN	1	135450903	missense	probably damaging	0.99
PIT4802001:Nav1	UTSW	1	135452933	missense	unknown
R0388:Nav1	UTSW	1	135448917	splice site	probably benign
R0390:Nav1	UTSW	1	135449966	missense	possibly damaging	0.80
R0395:Nav1	UTSW	1	135532621	nonsense	probably null
R0395:Nav1	UTSW	1	135532623	missense	probably damaging	0.97
R0416:Nav1	UTSW	1	135471126	missense	possibly damaging	0.73
R0463:Nav1	UTSW	1	135452207	missense	possibly damaging	0.76
R0538:Nav1	UTSW	1	135464692	splice site	probably benign
R0594:Nav1	UTSW	1	135467643	missense	possibly damaging	0.74
R0696:Nav1	UTSW	1	135532614	missense	probably damaging	0.99
R0699:Nav1	UTSW	1	135452949	missense	probably benign	0.00
R0759:Nav1	UTSW	1	135455260	missense	possibly damaging	0.73
R1164:Nav1	UTSW	1	135472410	missense	probably benign
R1169:Nav1	UTSW	1	135455205	missense	probably damaging	1.00
R1401:Nav1	UTSW	1	135460425	missense	probably benign	0.20
R1421:Nav1	UTSW	1	135585010	missense	probably damaging	1.00
R1642:Nav1	UTSW	1	135452272	missense	probably damaging	1.00
R1705:Nav1	UTSW	1	135584599	missense	probably damaging	1.00
R1713:Nav1	UTSW	1	135595234	intron	probably benign
R1728:Nav1	UTSW	1	135584727	missense	possibly damaging	0.82
R1729:Nav1	UTSW	1	135584727	missense	possibly damaging	0.82
R1730:Nav1	UTSW	1	135584727	missense	possibly damaging	0.82
R1739:Nav1	UTSW	1	135584727	missense	possibly damaging	0.82
R1740:Nav1	UTSW	1	135458389	critical splice donor site	probably null
R1762:Nav1	UTSW	1	135584727	missense	possibly damaging	0.82
R1783:Nav1	UTSW	1	135584727	missense	possibly damaging	0.82
R1784:Nav1	UTSW	1	135584727	missense	possibly damaging	0.82
R1785:Nav1	UTSW	1	135584727	missense	possibly damaging	0.82
R1895:Nav1	UTSW	1	135458658	missense	probably damaging	1.00
R1896:Nav1	UTSW	1	135460737	missense	probably benign	0.00
R1901:Nav1	UTSW	1	135472410	missense	probably benign	0.03
R1902:Nav1	UTSW	1	135472410	missense	probably benign	0.03
R1925:Nav1	UTSW	1	135607229	utr 5 prime	probably benign
R1939:Nav1	UTSW	1	135465898	missense	probably damaging	1.00
R1971:Nav1	UTSW	1	135532353	missense	probably benign	0.06
R2063:Nav1	UTSW	1	135449004	missense	probably damaging	1.00
R2066:Nav1	UTSW	1	135449004	missense	probably damaging	1.00
R2084:Nav1	UTSW	1	135607420	unclassified	probably benign
R2090:Nav1	UTSW	1	135607165	utr 5 prime	probably benign
R2107:Nav1	UTSW	1	135449004	missense	probably damaging	1.00
R2110:Nav1	UTSW	1	135449004	missense	probably damaging	1.00
R2111:Nav1	UTSW	1	135449004	missense	probably damaging	1.00
R2112:Nav1	UTSW	1	135449004	missense	probably damaging	1.00
R2136:Nav1	UTSW	1	135454436	missense	probably null	0.18
R2268:Nav1	UTSW	1	135472236	nonsense	probably null
R2269:Nav1	UTSW	1	135472236	nonsense	probably null
R2847:Nav1	UTSW	1	135450644	splice site	probably null
R2869:Nav1	UTSW	1	135460757	synonymous	silent
R2871:Nav1	UTSW	1	135460757	synonymous	silent
R2872:Nav1	UTSW	1	135460757	synonymous	silent
R2904:Nav1	UTSW	1	135585238	missense	probably benign
R3690:Nav1	UTSW	1	135467644	missense	probably benign	0.11
R3716:Nav1	UTSW	1	135450630	missense	probably damaging	1.00
R3717:Nav1	UTSW	1	135450630	missense	probably damaging	1.00
R3718:Nav1	UTSW	1	135450630	missense	probably damaging	1.00
R3815:Nav1	UTSW	1	135471124	missense	possibly damaging	0.95
R4282:Nav1	UTSW	1	135457913	intron	probably benign
R4361:Nav1	UTSW	1	135607437	unclassified	probably benign
R4610:Nav1	UTSW	1	135592448	intron	probably benign
R4730:Nav1	UTSW	1	135607311	unclassified	probably benign
R4784:Nav1	UTSW	1	135458739	missense	probably damaging	1.00
R4788:Nav1	UTSW	1	135469723	missense	probably benign
R4808:Nav1	UTSW	1	135455204	missense	probably damaging	1.00
R4996:Nav1	UTSW	1	135465971	missense	probably damaging	1.00
R5284:Nav1	UTSW	1	135449963	nonsense	probably null
R5514:Nav1	UTSW	1	135470561	missense	probably benign	0.04
R5769:Nav1	UTSW	1	135452257	missense	probably damaging	1.00
R5834:Nav1	UTSW	1	135532406	missense	probably benign	0.07
R5898:Nav1	UTSW	1	135585146	missense	probably benign
R6081:Nav1	UTSW	1	135470822	missense	probably damaging	1.00
R6344:Nav1	UTSW	1	135450796	missense	probably damaging	1.00
R6378:Nav1	UTSW	1	135454695	missense	probably damaging	1.00
R7001:Nav1	UTSW	1	135454611	splice site	probably null
R7185:Nav1	UTSW	1	135471008	missense	possibly damaging	0.85
R7361:Nav1	UTSW	1	135452853	missense	unknown
R7390:Nav1	UTSW	1	135584918	missense	probably benign	0.01
R7464:Nav1	UTSW	1	135584909	missense	probably benign	0.03
R7502:Nav1	UTSW	1	135469666	missense	probably damaging	1.00
R7601:Nav1	UTSW	1	135460438	missense	unknown
R7625:Nav1	UTSW	1	135467745	missense	probably damaging	1.00
R7639:Nav1	UTSW	1	135471122	missense	probably benign	0.09
R7786:Nav1	UTSW	1	135469995	missense	probably damaging	1.00
R7808:Nav1	UTSW	1	135452248	missense	unknown
R7815:Nav1	UTSW	1	135584639	missense	possibly damaging	0.49
R7825:Nav1	UTSW	1	135450044	missense	probably damaging	0.98
R8030:Nav1	UTSW	1	135537239	missense	probably damaging	1.00
R8370:Nav1	UTSW	1	135471144	nonsense	probably null
R8405:Nav1	UTSW	1	135454770	missense	unknown
R8720:Nav1	UTSW	1	135460726	missense	unknown
R8868:Nav1	UTSW	1	135585205	missense	probably benign	0.05
R8973:Nav1	UTSW	1	135584725	missense	probably benign	0.01
R9039:Nav1	UTSW	1	135443749	missense	unknown
R9261:Nav1	UTSW	1	135460357	missense	unknown
R9523:Nav1	UTSW	1	135452191	missense	unknown
Z1088:Nav1	UTSW	1	135470724	missense	probably benign	0.01
Z1176:Nav1	UTSW	1	135452886	missense	unknown
Z1176:Nav1	UTSW	1	135472420	missense	probably damaging	1.00
Z1177:Nav1	UTSW	1	135469731	missense	possibly damaging	0.56

Predicted Primers

PCR Primer
(F):5'- AGACAGAACTGAAATGGCCC -3'
(R):5'- TAACCTCCAGCTGCTTGCAC -3'

Sequencing Primer
(F):5'- AATGGCCCAAGTTGATGTCC -3'
(R):5'- ACCAGAGAGCTGATGACCCTG -3'

Posted On

2019-06-26