Mutagenetix > Incidental Mutation

Incidental Mutation 'R7291:Kif26b'

566380

Institutional Source

Beutler Lab

Gene Symbol

Kif26b

Ensembl Gene

ENSMUSG00000026494

Gene Name

kinesin family member 26B

Synonyms

D230039L06Rik, N-11 kinesin

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7291 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

178529125-178939200 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 178679046 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 229 (T229I)

Ref Sequence

ENSEMBL: ENSMUSP00000124462 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000161017]

AlphaFold

Q7TNC6

Predicted Effect

possibly damaging
Transcript: ENSMUST00000161017
AA Change: T229I

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000124462
Gene: ENSMUSG00000026494
AA Change: T229I

Domain	Start	End	E-Value	Type
low complexity region	58	123	N/A	INTRINSIC
low complexity region	144	155	N/A	INTRINSIC
low complexity region	220	228	N/A	INTRINSIC
Blast:KISc	365	446	4e-8	BLAST
KISc	448	809	2.48e-42	SMART
low complexity region	810	822	N/A	INTRINSIC
low complexity region	849	863	N/A	INTRINSIC
low complexity region	907	913	N/A	INTRINSIC
low complexity region	1007	1047	N/A	INTRINSIC
low complexity region	1099	1109	N/A	INTRINSIC
low complexity region	1269	1288	N/A	INTRINSIC
low complexity region	1485	1495	N/A	INTRINSIC
low complexity region	1741	1769	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality with impaired kidney development due to loss of cortical nephrogenic zone mesenchyme and failure of ureteric buds to invade and branch into the mesenchyme. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9430069I07Rik	T	C	15: 34,355,553	E51G	possibly damaging	Het
9530053A07Rik	A	C	7: 28,140,220	D486A	probably benign	Het
Abca14	C	A	7: 120,289,609	C1259*	probably null	Het
Ablim1	T	C	19: 57,215,908	E17G	probably benign	Het
Acsf3	G	A	8: 122,813,577	V505I	probably benign	Het
Actn1	T	C	12: 80,174,085	M650V	probably benign	Het
Adamts4	G	A	1: 171,256,528	V525I	probably benign	Het
Adh1	T	C	3: 138,282,808	Y181H	probably damaging	Het
Alpl	G	A	4: 137,752,698	R168W	probably damaging	Het
Ate1	T	G	7: 130,519,931	K11Q	probably benign	Het
Atpaf1	T	A	4: 115,811,091	F314L	probably damaging	Het
Baiap3	T	A	17: 25,244,317	D1004V	probably damaging	Het
Bpifb9a	C	T	2: 154,267,696	T504M	probably damaging	Het
C1s2	T	A	6: 124,625,384	I623F	probably benign	Het
Card11	T	C	5: 140,901,070	D308G	probably damaging	Het
Cul9	C	T	17: 46,540,433	V354I	probably benign	Het
Dnah1	A	T	14: 31,298,705	F1236I	probably damaging	Het
Dync2h1	T	A	9: 6,929,590	I4266F	possibly damaging	Het
Ear10	A	T	14: 43,922,920	V150D	probably damaging	Het
Elfn2	C	T	15: 78,672,983	A455T	probably benign	Het
Erp44	A	G	4: 48,208,792	Y223H	probably damaging	Het
Fam110b	T	A	4: 5,798,895	H104Q	probably benign	Het
Fcgbp	A	G	7: 28,101,392	N1288D	probably benign	Het
Fcrl1	T	C	3: 87,385,781		probably null	Het
Fmo2	G	T	1: 162,887,702	P117Q	probably benign	Het
Fsip2	A	G	2: 82,980,519	K2394R	possibly damaging	Het
Gab1	T	G	8: 80,800,151	K106T	probably damaging	Het
Gatad2b	T	C	3: 90,351,414	V248A	probably damaging	Het
Gemin6	T	C	17: 80,227,775	S55P	possibly damaging	Het
Gfm2	G	A	13: 97,175,024	V701I	probably benign	Het
Gm3250	T	C	10: 77,782,227	T106A	unknown	Het
Gm7356	T	C	17: 14,001,581	N62S	probably benign	Het
Gsdmc4	T	C	15: 63,902,840	T31A	possibly damaging	Het
H2-M10.1	T	A	17: 36,325,729	D61V	probably damaging	Het
Heatr5a	A	G	12: 51,925,339	L716S	probably damaging	Het
Hecw2	A	G	1: 53,914,594	Y831H	probably damaging	Het
Ifi202b	C	T	1: 173,974,815	S151N	probably benign	Het
Il15ra	C	T	2: 11,718,381	T72I	probably damaging	Het
Ints1	A	G	5: 139,765,074	L858P	probably damaging	Het
Kat2a	C	T	11: 100,710,900	V230I	possibly damaging	Het
Kcnq2	A	T	2: 181,088,379	I498N	possibly damaging	Het
Ly75	T	A	2: 60,329,993	I957F	probably damaging	Het
Map3k12	T	A	15: 102,502,166	R459W	probably damaging	Het
Mia2	T	A	12: 59,158,369		probably null	Het
Mrgprf	A	G	7: 145,307,469	I53V	unknown	Het
Mttp	A	G	3: 138,091,203	L846P	probably damaging	Het
Myrip	C	T	9: 120,417,141	L112F	probably damaging	Het
Nav1	A	G	1: 135,465,859	F1047S	probably damaging	Het
Nfkbib	T	C	7: 28,759,203	D327G	possibly damaging	Het
Notch1	C	T	2: 26,476,375	V776I	probably benign	Het
Obsl1	G	T	1: 75,489,517	D1522E	probably damaging	Het
Olfr1464-ps1	A	T	19: 13,282,153	F302I	unknown	Het
Olfr605	T	A	7: 103,442,788	M112L	probably benign	Het
Olfr823	T	C	10: 130,112,224	K189E	probably benign	Het
Olfr859	T	C	9: 19,808,648	M110T	possibly damaging	Het
Pde7a	T	C	3: 19,227,674	N471D	probably benign	Het
Pla2r1	T	C	2: 60,530,435	H203R	probably benign	Het
Plch2	C	A	4: 154,998,472	C573F	probably damaging	Het
Polr1a	G	A	6: 71,941,456	R666Q	probably benign	Het
Prepl	T	C	17: 85,081,240	N145S	probably benign	Het
Psen2	C	T	1: 180,238,956	V139M	probably benign	Het
Ptgdr	A	T	14: 44,859,192	M21K	possibly damaging	Het
Rapgef6	T	C	11: 54,691,239	W1331R	probably benign	Het
Rp1l1	G	A	14: 64,032,298	G1778S	probably benign	Het
Rrbp1	A	T	2: 143,969,462	M824K	probably benign	Het
Sel1l	T	C	12: 91,848,965	T23A	probably benign	Het
Sele	A	G	1: 164,053,868	S515G	possibly damaging	Het
Slc22a23	T	C	13: 34,197,839	N421D	probably damaging	Het
Slc35f3	T	G	8: 126,394,558	L386R	probably benign	Het
Stab2	G	A	10: 86,946,220	S699L	probably damaging	Het
Synrg	A	T	11: 84,009,381	L726F	probably damaging	Het
Syt3	G	A	7: 44,395,919	V528M	probably damaging	Het
Szt2	A	G	4: 118,391,249	I655T	probably damaging	Het
Tbr1	T	C	2: 61,812,256	S622P	probably damaging	Het
Tex36	C	T	7: 133,587,223	G207S	probably benign	Het
Trav5n-4	G	A	14: 53,312,942	W13*	probably null	Het
Trdn	A	T	10: 33,437,736	E500V	probably null	Het
Ugt2b38	A	T	5: 87,411,895	N379K	probably damaging	Het
Unc13d	T	C	11: 116,074,050	R248G	possibly damaging	Het
Vmn1r195	C	T	13: 22,278,749	L130F	probably damaging	Het
Vmn2r110	T	C	17: 20,574,209	I733V	probably benign	Het
Zfp870	T	A	17: 32,883,854	N167I	probably damaging	Het
Zmynd10	A	T	9: 107,549,304	M179L	probably benign	Het

Other mutations in Kif26b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00337:Kif26b	APN	1	178915648	missense	probably damaging	1.00
IGL00425:Kif26b	APN	1	178916301	missense	probably damaging	0.96
IGL00952:Kif26b	APN	1	178932205	missense	probably damaging	1.00
IGL01100:Kif26b	APN	1	178917244	missense	probably benign
IGL01347:Kif26b	APN	1	178870675	missense	probably damaging	1.00
IGL01543:Kif26b	APN	1	178678961	missense	probably benign	0.41
IGL01938:Kif26b	APN	1	178916038	missense	probably damaging	0.99
IGL02100:Kif26b	APN	1	178915947	missense	probably damaging	0.99
IGL02262:Kif26b	APN	1	178916068	missense	probably benign	0.05
IGL02576:Kif26b	APN	1	178916347	missense	probably benign
IGL02673:Kif26b	APN	1	178821605	missense	probably damaging	1.00
IGL03078:Kif26b	APN	1	178870726	missense	probably damaging	1.00
IGL03155:Kif26b	APN	1	178874128	missense	probably damaging	1.00
IGL03157:Kif26b	APN	1	178916365	missense	probably damaging	1.00
IGL03162:Kif26b	APN	1	178916932	missense	probably benign
IGL03220:Kif26b	APN	1	178864869	missense	probably damaging	1.00
IGL03299:Kif26b	APN	1	178821560	missense	probably benign	0.09
IGL03368:Kif26b	APN	1	178916208	missense	probably damaging	1.00
IGL03370:Kif26b	APN	1	178915381	missense	probably benign	0.39
PIT4449001:Kif26b	UTSW	1	178918086	missense	probably damaging	1.00
R0142:Kif26b	UTSW	1	178915389	missense	probably damaging	1.00
R0621:Kif26b	UTSW	1	178915653	missense	probably benign	0.02
R0987:Kif26b	UTSW	1	178821620	missense	probably damaging	1.00
R1107:Kif26b	UTSW	1	178917673	missense	probably benign	0.03
R1367:Kif26b	UTSW	1	178916463	missense	probably damaging	1.00
R1386:Kif26b	UTSW	1	178915644	missense	probably benign
R1619:Kif26b	UTSW	1	178916478	missense	probably benign	0.00
R1664:Kif26b	UTSW	1	178932139	missense	probably damaging	1.00
R2240:Kif26b	UTSW	1	178715923	missense	probably benign	0.00
R2264:Kif26b	UTSW	1	178928842	critical splice acceptor site	probably null
R2443:Kif26b	UTSW	1	178915014	missense	probably damaging	0.99
R3023:Kif26b	UTSW	1	178864868	missense	probably damaging	0.99
R3744:Kif26b	UTSW	1	178679030	missense	probably benign	0.00
R3831:Kif26b	UTSW	1	178916616	frame shift	probably null
R3832:Kif26b	UTSW	1	178916616	frame shift	probably null
R3833:Kif26b	UTSW	1	178916616	frame shift	probably null
R3843:Kif26b	UTSW	1	178928177	missense	probably damaging	1.00
R4108:Kif26b	UTSW	1	178916965	missense	possibly damaging	0.88
R4181:Kif26b	UTSW	1	178915426	missense	probably damaging	0.98
R4551:Kif26b	UTSW	1	178884035	missense	probably damaging	1.00
R4552:Kif26b	UTSW	1	178884035	missense	probably damaging	1.00
R4597:Kif26b	UTSW	1	178916793	missense	probably damaging	1.00
R4599:Kif26b	UTSW	1	178530459	missense	unknown
R4610:Kif26b	UTSW	1	178679355	missense	probably damaging	1.00
R4746:Kif26b	UTSW	1	178873981	nonsense	probably null
R4873:Kif26b	UTSW	1	178915327	missense	probably benign	0.38
R4875:Kif26b	UTSW	1	178915327	missense	probably benign	0.38
R5015:Kif26b	UTSW	1	178928330	missense	probably damaging	0.99
R5060:Kif26b	UTSW	1	178530630	missense	unknown
R5301:Kif26b	UTSW	1	178530668	missense	unknown
R5368:Kif26b	UTSW	1	178915884	missense	probably damaging	1.00
R5387:Kif26b	UTSW	1	178914876	missense	probably benign	0.01
R5589:Kif26b	UTSW	1	178916299	missense	probably benign	0.05
R6150:Kif26b	UTSW	1	178915546	missense	probably damaging	1.00
R6259:Kif26b	UTSW	1	178917405	missense	probably damaging	0.97
R6355:Kif26b	UTSW	1	178916178	missense	probably damaging	1.00
R6408:Kif26b	UTSW	1	178917568	missense	probably damaging	1.00
R6488:Kif26b	UTSW	1	178529573	missense	unknown
R6546:Kif26b	UTSW	1	178928306	missense	probably damaging	1.00
R6702:Kif26b	UTSW	1	178917287	missense	possibly damaging	0.90
R6886:Kif26b	UTSW	1	178874138	missense	probably damaging	1.00
R6953:Kif26b	UTSW	1	178874072	missense	possibly damaging	0.89
R7262:Kif26b	UTSW	1	178917654	missense	possibly damaging	0.84
R7346:Kif26b	UTSW	1	178530741	missense	probably damaging	1.00
R7383:Kif26b	UTSW	1	178530710	missense	probably damaging	1.00
R7448:Kif26b	UTSW	1	178914774	missense	probably damaging	1.00
R7506:Kif26b	UTSW	1	178529499	start gained	probably benign
R7562:Kif26b	UTSW	1	178914976	missense	probably damaging	1.00
R7583:Kif26b	UTSW	1	178530445	nonsense	probably null
R7585:Kif26b	UTSW	1	178916496	missense	probably benign	0.01
R7644:Kif26b	UTSW	1	178679274	missense	probably benign	0.04
R7759:Kif26b	UTSW	1	178678944	missense	probably damaging	1.00
R7775:Kif26b	UTSW	1	178864876	missense	probably benign	0.15
R7954:Kif26b	UTSW	1	178869379	missense	probably damaging	0.99
R7960:Kif26b	UTSW	1	178678919	missense	probably damaging	1.00
R8012:Kif26b	UTSW	1	178916250	missense	probably benign	0.20
R8152:Kif26b	UTSW	1	178679229	missense	possibly damaging	0.46
R8320:Kif26b	UTSW	1	178884076	critical splice donor site	probably null
R8360:Kif26b	UTSW	1	178916373	missense	probably benign	0.18
R8428:Kif26b	UTSW	1	178917358	missense	probably benign	0.09
R8670:Kif26b	UTSW	1	178913784	missense	probably damaging	1.00
R8737:Kif26b	UTSW	1	178864865	missense	probably damaging	0.99
R8788:Kif26b	UTSW	1	178529525	start gained	probably benign
R8854:Kif26b	UTSW	1	178916383	missense	possibly damaging	0.93
R8870:Kif26b	UTSW	1	178865029	missense	probably damaging	1.00
R8963:Kif26b	UTSW	1	178916149	missense	probably benign	0.00
R9232:Kif26b	UTSW	1	178914946	missense	probably damaging	1.00
R9297:Kif26b	UTSW	1	178715809	nonsense	probably null
R9338:Kif26b	UTSW	1	178916493	missense	probably damaging	1.00
R9572:Kif26b	UTSW	1	178917477	missense	probably benign
R9580:Kif26b	UTSW	1	178679078	nonsense	probably null
R9694:Kif26b	UTSW	1	178916250	missense	probably benign	0.20
X0021:Kif26b	UTSW	1	178928159	missense	probably damaging	1.00
X0024:Kif26b	UTSW	1	178679082	missense	probably benign	0.14
X0025:Kif26b	UTSW	1	178915266	nonsense	probably null
X0025:Kif26b	UTSW	1	178915383	missense	possibly damaging	0.70
Z1177:Kif26b	UTSW	1	178821548	missense	probably benign	0.11
Z1177:Kif26b	UTSW	1	178821550	nonsense	probably null
Z1177:Kif26b	UTSW	1	178915405	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CAGGAAGTCGTGGAATGACC -3'
(R):5'- CACCGAGTTGAGGATGTTTCC -3'

Sequencing Primer
(F):5'- CGAGACAACCGCTGTGACATTTG -3'
(R):5'- ACTGGTGGCCATCTGGAG -3'

Posted On

2019-06-26