Incidental Mutation 'R7291:Alpl'
ID566400
Institutional Source Beutler Lab
Gene Symbol Alpl
Ensembl Gene ENSMUSG00000028766
Gene Namealkaline phosphatase, liver/bone/kidney
SynonymsTNSALP, TNAP, Akp-2, Akp2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7291 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location137741733-137796384 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 137752698 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 168 (R168W)
Ref Sequence ENSEMBL: ENSMUSP00000030551 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030551] [ENSMUST00000133473] [ENSMUST00000139951] [ENSMUST00000153588]
Predicted Effect probably damaging
Transcript: ENSMUST00000030551
AA Change: R168W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030551
Gene: ENSMUSG00000028766
AA Change: R168W

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
alkPPc 52 491 4.69e-285 SMART
low complexity region 500 520 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133473
SMART Domains Protein: ENSMUSP00000121548
Gene: ENSMUSG00000028766

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Alk_phosphatase 51 98 5.3e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000139951
AA Change: R168W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125041
Gene: ENSMUSG00000028766
AA Change: R168W

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Alk_phosphatase 51 216 5.2e-72 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153588
SMART Domains Protein: ENSMUSP00000116308
Gene: ENSMUSG00000028766

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Alk_phosphatase 51 158 2e-44 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a preproprotein that is proteolytically cleaved to yield a signal peptide and a proproptein that is subsequently processed to generate the active mature peptide. The encoded protein is a membrane-bound glycosylated enzyme that catalyzes the hydrolysis of phosphate esters at alkaline pH. The mature peptide maintains the ratio of inorganic phosphate to inorganic pyrophosphate required for bone mineralization. Mice that lack this enzyme show symptoms of osteomalacia, softening of the bones. In humans, mutations in this gene are associated with hypophosphatasia, an inherited metabolic bone disease in which deficiency of this enzyme inhibits bone mineralization leading to skeletal defects. Mutations in the mouse gene mirror the symptoms of human hypophosphatasia. A pseudogene of this gene is present on chromosome X. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
PHENOTYPE: Males hemizygous for a null mutation exhibit reduced body size, shortened hindlimbs and tail, osteomalacia, and markedly reduced plasma phosphate levels due to impaired kidney reabsorption. Female heterozygotes exhibit milder symptoms. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430069I07Rik T C 15: 34,355,553 E51G possibly damaging Het
9530053A07Rik A C 7: 28,140,220 D486A probably benign Het
Abca14 C A 7: 120,289,609 C1259* probably null Het
Ablim1 T C 19: 57,215,908 E17G probably benign Het
Acsf3 G A 8: 122,813,577 V505I probably benign Het
Actn1 T C 12: 80,174,085 M650V probably benign Het
Adamts4 G A 1: 171,256,528 V525I probably benign Het
Adh1 T C 3: 138,282,808 Y181H probably damaging Het
Ate1 T G 7: 130,519,931 K11Q probably benign Het
Atpaf1 T A 4: 115,811,091 F314L probably damaging Het
Baiap3 T A 17: 25,244,317 D1004V probably damaging Het
Bpifb9a C T 2: 154,267,696 T504M probably damaging Het
C1s2 T A 6: 124,625,384 I623F probably benign Het
Card11 T C 5: 140,901,070 D308G probably damaging Het
Cul9 C T 17: 46,540,433 V354I probably benign Het
Dnah1 A T 14: 31,298,705 F1236I probably damaging Het
Dync2h1 T A 9: 6,929,590 I4266F possibly damaging Het
Ear10 A T 14: 43,922,920 V150D probably damaging Het
Elfn2 C T 15: 78,672,983 A455T probably benign Het
Erp44 A G 4: 48,208,792 Y223H probably damaging Het
Fam110b T A 4: 5,798,895 H104Q probably benign Het
Fcgbp A G 7: 28,101,392 N1288D probably benign Het
Fcrl1 T C 3: 87,385,781 probably null Het
Fmo2 G T 1: 162,887,702 P117Q probably benign Het
Fsip2 A G 2: 82,980,519 K2394R possibly damaging Het
Gab1 T G 8: 80,800,151 K106T probably damaging Het
Gatad2b T C 3: 90,351,414 V248A probably damaging Het
Gemin6 T C 17: 80,227,775 S55P possibly damaging Het
Gfm2 G A 13: 97,175,024 V701I probably benign Het
Gm3250 T C 10: 77,782,227 T106A unknown Het
Gm7356 T C 17: 14,001,581 N62S probably benign Het
Gsdmc4 T C 15: 63,902,840 T31A possibly damaging Het
H2-M10.1 T A 17: 36,325,729 D61V probably damaging Het
Heatr5a A G 12: 51,925,339 L716S probably damaging Het
Hecw2 A G 1: 53,914,594 Y831H probably damaging Het
Ifi202b C T 1: 173,974,815 S151N probably benign Het
Il15ra C T 2: 11,718,381 T72I probably damaging Het
Ints1 A G 5: 139,765,074 L858P probably damaging Het
Kat2a C T 11: 100,710,900 V230I possibly damaging Het
Kcnq2 A T 2: 181,088,379 I498N possibly damaging Het
Kif26b C T 1: 178,679,046 T229I possibly damaging Het
Ly75 T A 2: 60,329,993 I957F probably damaging Het
Map3k12 T A 15: 102,502,166 R459W probably damaging Het
Mia2 T A 12: 59,158,369 probably null Het
Mrgprf A G 7: 145,307,469 I53V unknown Het
Mttp A G 3: 138,091,203 L846P probably damaging Het
Myrip C T 9: 120,417,141 L112F probably damaging Het
Nav1 A G 1: 135,465,859 F1047S probably damaging Het
Nfkbib T C 7: 28,759,203 D327G possibly damaging Het
Notch1 C T 2: 26,476,375 V776I probably benign Het
Obsl1 G T 1: 75,489,517 D1522E probably damaging Het
Olfr1464-ps1 A T 19: 13,282,153 F302I unknown Het
Olfr605 T A 7: 103,442,788 M112L probably benign Het
Olfr823 T C 10: 130,112,224 K189E probably benign Het
Olfr859 T C 9: 19,808,648 M110T possibly damaging Het
Pde7a T C 3: 19,227,674 N471D probably benign Het
Pla2r1 T C 2: 60,530,435 H203R probably benign Het
Plch2 C A 4: 154,998,472 C573F probably damaging Het
Polr1a G A 6: 71,941,456 R666Q probably benign Het
Prepl T C 17: 85,081,240 N145S probably benign Het
Psen2 C T 1: 180,238,956 V139M probably benign Het
Ptgdr A T 14: 44,859,192 M21K possibly damaging Het
Rapgef6 T C 11: 54,691,239 W1331R probably benign Het
Rp1l1 G A 14: 64,032,298 G1778S probably benign Het
Rrbp1 A T 2: 143,969,462 M824K probably benign Het
Sel1l T C 12: 91,848,965 T23A probably benign Het
Sele A G 1: 164,053,868 S515G possibly damaging Het
Slc22a23 T C 13: 34,197,839 N421D probably damaging Het
Slc35f3 T G 8: 126,394,558 L386R probably benign Het
Stab2 G A 10: 86,946,220 S699L probably damaging Het
Synrg A T 11: 84,009,381 L726F probably damaging Het
Syt3 G A 7: 44,395,919 V528M probably damaging Het
Szt2 A G 4: 118,391,249 I655T probably damaging Het
Tbr1 T C 2: 61,812,256 S622P probably damaging Het
Tex36 C T 7: 133,587,223 G207S probably benign Het
Trav5n-4 G A 14: 53,312,942 W13* probably null Het
Trdn A T 10: 33,437,736 E500V probably null Het
Ugt2b38 A T 5: 87,411,895 N379K probably damaging Het
Unc13d T C 11: 116,074,050 R248G possibly damaging Het
Vmn1r195 C T 13: 22,278,749 L130F probably damaging Het
Vmn2r110 T C 17: 20,574,209 I733V probably benign Het
Zfp870 T A 17: 32,883,854 N167I probably damaging Het
Zmynd10 A T 9: 107,549,304 M179L probably benign Het
Other mutations in Alpl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01099:Alpl APN 4 137743313 splice site probably benign
IGL02164:Alpl APN 4 137753979 missense probably damaging 1.00
IGL02379:Alpl APN 4 137742558 missense probably damaging 1.00
IGL02632:Alpl APN 4 137753906 missense probably damaging 0.98
IGL02926:Alpl APN 4 137742634 missense probably damaging 1.00
R0492:Alpl UTSW 4 137749576 splice site probably null
R1157:Alpl UTSW 4 137754020 missense probably damaging 1.00
R2013:Alpl UTSW 4 137755147 missense probably benign 0.00
R2067:Alpl UTSW 4 137749545 unclassified probably benign
R4412:Alpl UTSW 4 137758628 missense possibly damaging 0.84
R4440:Alpl UTSW 4 137747813 missense probably damaging 1.00
R5275:Alpl UTSW 4 137749608 missense probably benign 0.00
R5295:Alpl UTSW 4 137749608 missense probably benign 0.00
R5529:Alpl UTSW 4 137746422 missense probably damaging 0.99
R6706:Alpl UTSW 4 137746429 missense probably benign 0.00
R7693:Alpl UTSW 4 137743809 missense probably damaging 1.00
R7694:Alpl UTSW 4 137743809 missense probably damaging 1.00
R8247:Alpl UTSW 4 137746453 missense probably damaging 1.00
R8686:Alpl UTSW 4 137743801 missense probably damaging 1.00
R8725:Alpl UTSW 4 137747816 missense probably benign
R8727:Alpl UTSW 4 137747816 missense probably benign
X0017:Alpl UTSW 4 137746467 missense probably damaging 1.00
Z1176:Alpl UTSW 4 137754010 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGGGTTGGGAGCTCTTCC -3'
(R):5'- TCATGTAACCTAGGGAAACTGAG -3'

Sequencing Primer
(F):5'- TTCCTAGGCCACCCTGG -3'
(R):5'- AGGCCCAGGCAACCAGAG -3'
Posted On2019-06-26