Incidental Mutation 'R7291:Plch2'
ID566401
Institutional Source Beutler Lab
Gene Symbol Plch2
Ensembl Gene ENSMUSG00000029055
Gene Namephospholipase C, eta 2
SynonymsPlcl4, A930027K05Rik, PLCeta2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7291 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location154983115-155056784 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 154998472 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 573 (C573F)
Ref Sequence ENSEMBL: ENSMUSP00000122704 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105631] [ENSMUST00000135665] [ENSMUST00000139976] [ENSMUST00000145662] [ENSMUST00000176194] [ENSMUST00000186598]
Predicted Effect possibly damaging
Transcript: ENSMUST00000105631
AA Change: C573F

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000101256
Gene: ENSMUSG00000029055
AA Change: C573F

DomainStartEndE-ValueType
low complexity region 28 45 N/A INTRINSIC
low complexity region 96 107 N/A INTRINSIC
PH 122 231 1.8e-6 SMART
EFh 247 275 7.29e-4 SMART
EFh 283 312 4.67e-2 SMART
Pfam:EF-hand_like 317 399 1.7e-26 PFAM
PLCXc 400 545 6.76e-76 SMART
low complexity region 559 572 N/A INTRINSIC
low complexity region 659 676 N/A INTRINSIC
PLCYc 707 821 1.25e-56 SMART
C2 840 948 1.66e-21 SMART
low complexity region 1088 1107 N/A INTRINSIC
low complexity region 1227 1236 N/A INTRINSIC
low complexity region 1356 1369 N/A INTRINSIC
low complexity region 1421 1451 N/A INTRINSIC
low complexity region 1454 1466 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000135665
AA Change: C468F

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000118292
Gene: ENSMUSG00000029055
AA Change: C468F

DomainStartEndE-ValueType
PH 17 126 1.8e-6 SMART
EFh 142 170 7.29e-4 SMART
EFh 178 207 4.67e-2 SMART
Pfam:EF-hand_like 212 294 2.8e-25 PFAM
PLCXc 295 440 6.76e-76 SMART
low complexity region 454 467 N/A INTRINSIC
low complexity region 554 571 N/A INTRINSIC
PLCYc 602 716 1.25e-56 SMART
C2 735 843 1.66e-21 SMART
low complexity region 983 1002 N/A INTRINSIC
low complexity region 1122 1131 N/A INTRINSIC
low complexity region 1251 1264 N/A INTRINSIC
low complexity region 1316 1346 N/A INTRINSIC
low complexity region 1349 1361 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000139976
AA Change: C573F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000122704
Gene: ENSMUSG00000029055
AA Change: C573F

DomainStartEndE-ValueType
low complexity region 28 45 N/A INTRINSIC
low complexity region 96 107 N/A INTRINSIC
PH 122 231 1.8e-6 SMART
EFh 247 275 7.29e-4 SMART
EFh 283 312 4.67e-2 SMART
Pfam:EF-hand_like 317 399 3.2e-27 PFAM
PLCXc 400 545 6.76e-76 SMART
low complexity region 559 572 N/A INTRINSIC
low complexity region 659 676 N/A INTRINSIC
PLCYc 707 821 1.25e-56 SMART
C2 840 948 1.66e-21 SMART
low complexity region 1087 1100 N/A INTRINSIC
low complexity region 1166 1194 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000145662
AA Change: C497F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119864
Gene: ENSMUSG00000029055
AA Change: C497F

DomainStartEndE-ValueType
PH 46 155 1.8e-6 SMART
EFh 171 199 7.29e-4 SMART
EFh 207 236 4.67e-2 SMART
Pfam:EF-hand_like 241 323 5.2e-27 PFAM
PLCXc 324 469 6.76e-76 SMART
low complexity region 483 496 N/A INTRINSIC
Predicted Effect
Predicted Effect possibly damaging
Transcript: ENSMUST00000176194
AA Change: C472F

PolyPhen 2 Score 0.702 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000134750
Gene: ENSMUSG00000029055
AA Change: C472F

DomainStartEndE-ValueType
PH 21 130 1.8e-6 SMART
EFh 146 174 7.29e-4 SMART
EFh 182 211 4.67e-2 SMART
Pfam:EF-hand_like 216 298 1.6e-25 PFAM
PLCXc 299 444 6.76e-76 SMART
low complexity region 458 471 N/A INTRINSIC
low complexity region 558 575 N/A INTRINSIC
PLCYc 606 720 1.25e-56 SMART
C2 739 847 1.66e-21 SMART
low complexity region 986 999 N/A INTRINSIC
low complexity region 1065 1093 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186598
SMART Domains Protein: ENSMUSP00000141152
Gene: ENSMUSG00000029055

DomainStartEndE-ValueType
C2 79 189 5.8e-18 SMART
low complexity region 328 341 N/A INTRINSIC
low complexity region 407 435 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PLCH2 is a member of the PLC-eta family of the phosphoinositide-specific phospholipase C (PLC) superfamily of enzymes that cleave PtdIns(4,5) P2 to generate second messengers inositol 1,4,5-trisphosphate and diacylglycerol (Zhou et al., 2005 [PubMed 16107206]).[supplied by OMIM, Jun 2009]
PHENOTYPE: Mice homozygous for a reporter allele exhibit no apparent abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430069I07Rik T C 15: 34,355,553 E51G possibly damaging Het
9530053A07Rik A C 7: 28,140,220 D486A probably benign Het
Abca14 C A 7: 120,289,609 C1259* probably null Het
Ablim1 T C 19: 57,215,908 E17G probably benign Het
Acsf3 G A 8: 122,813,577 V505I probably benign Het
Actn1 T C 12: 80,174,085 M650V probably benign Het
Adamts4 G A 1: 171,256,528 V525I probably benign Het
Adh1 T C 3: 138,282,808 Y181H probably damaging Het
Alpl G A 4: 137,752,698 R168W probably damaging Het
Ate1 T G 7: 130,519,931 K11Q probably benign Het
Atpaf1 T A 4: 115,811,091 F314L probably damaging Het
Baiap3 T A 17: 25,244,317 D1004V probably damaging Het
Bpifb9a C T 2: 154,267,696 T504M probably damaging Het
C1s2 T A 6: 124,625,384 I623F probably benign Het
Card11 T C 5: 140,901,070 D308G probably damaging Het
Cul9 C T 17: 46,540,433 V354I probably benign Het
Dnah1 A T 14: 31,298,705 F1236I probably damaging Het
Dync2h1 T A 9: 6,929,590 I4266F possibly damaging Het
Ear10 A T 14: 43,922,920 V150D probably damaging Het
Elfn2 C T 15: 78,672,983 A455T probably benign Het
Erp44 A G 4: 48,208,792 Y223H probably damaging Het
Fam110b T A 4: 5,798,895 H104Q probably benign Het
Fcgbp A G 7: 28,101,392 N1288D probably benign Het
Fcrl1 T C 3: 87,385,781 probably null Het
Fmo2 G T 1: 162,887,702 P117Q probably benign Het
Fsip2 A G 2: 82,980,519 K2394R possibly damaging Het
Gab1 T G 8: 80,800,151 K106T probably damaging Het
Gatad2b T C 3: 90,351,414 V248A probably damaging Het
Gemin6 T C 17: 80,227,775 S55P possibly damaging Het
Gfm2 G A 13: 97,175,024 V701I probably benign Het
Gm3250 T C 10: 77,782,227 T106A unknown Het
Gm7356 T C 17: 14,001,581 N62S probably benign Het
Gsdmc4 T C 15: 63,902,840 T31A possibly damaging Het
H2-M10.1 T A 17: 36,325,729 D61V probably damaging Het
Heatr5a A G 12: 51,925,339 L716S probably damaging Het
Hecw2 A G 1: 53,914,594 Y831H probably damaging Het
Ifi202b C T 1: 173,974,815 S151N probably benign Het
Il15ra C T 2: 11,718,381 T72I probably damaging Het
Ints1 A G 5: 139,765,074 L858P probably damaging Het
Kat2a C T 11: 100,710,900 V230I possibly damaging Het
Kcnq2 A T 2: 181,088,379 I498N possibly damaging Het
Kif26b C T 1: 178,679,046 T229I possibly damaging Het
Ly75 T A 2: 60,329,993 I957F probably damaging Het
Map3k12 T A 15: 102,502,166 R459W probably damaging Het
Mia2 T A 12: 59,158,369 probably null Het
Mrgprf A G 7: 145,307,469 I53V unknown Het
Mttp A G 3: 138,091,203 L846P probably damaging Het
Myrip C T 9: 120,417,141 L112F probably damaging Het
Nav1 A G 1: 135,465,859 F1047S probably damaging Het
Nfkbib T C 7: 28,759,203 D327G possibly damaging Het
Notch1 C T 2: 26,476,375 V776I probably benign Het
Obsl1 G T 1: 75,489,517 D1522E probably damaging Het
Olfr1464-ps1 A T 19: 13,282,153 F302I unknown Het
Olfr605 T A 7: 103,442,788 M112L probably benign Het
Olfr823 T C 10: 130,112,224 K189E probably benign Het
Olfr859 T C 9: 19,808,648 M110T possibly damaging Het
Pde7a T C 3: 19,227,674 N471D probably benign Het
Pla2r1 T C 2: 60,530,435 H203R probably benign Het
Polr1a G A 6: 71,941,456 R666Q probably benign Het
Prepl T C 17: 85,081,240 N145S probably benign Het
Psen2 C T 1: 180,238,956 V139M probably benign Het
Ptgdr A T 14: 44,859,192 M21K possibly damaging Het
Rapgef6 T C 11: 54,691,239 W1331R probably benign Het
Rp1l1 G A 14: 64,032,298 G1778S probably benign Het
Rrbp1 A T 2: 143,969,462 M824K probably benign Het
Sel1l T C 12: 91,848,965 T23A probably benign Het
Sele A G 1: 164,053,868 S515G possibly damaging Het
Slc22a23 T C 13: 34,197,839 N421D probably damaging Het
Slc35f3 T G 8: 126,394,558 L386R probably benign Het
Stab2 G A 10: 86,946,220 S699L probably damaging Het
Synrg A T 11: 84,009,381 L726F probably damaging Het
Syt3 G A 7: 44,395,919 V528M probably damaging Het
Szt2 A G 4: 118,391,249 I655T probably damaging Het
Tbr1 T C 2: 61,812,256 S622P probably damaging Het
Tex36 C T 7: 133,587,223 G207S probably benign Het
Trav5n-4 G A 14: 53,312,942 W13* probably null Het
Trdn A T 10: 33,437,736 E500V probably null Het
Ugt2b38 A T 5: 87,411,895 N379K probably damaging Het
Unc13d T C 11: 116,074,050 R248G possibly damaging Het
Vmn1r195 C T 13: 22,278,749 L130F probably damaging Het
Vmn2r110 T C 17: 20,574,209 I733V probably benign Het
Zfp870 T A 17: 32,883,854 N167I probably damaging Het
Zmynd10 A T 9: 107,549,304 M179L probably benign Het
Other mutations in Plch2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Plch2 APN 4 155006642 missense probably damaging 1.00
IGL02024:Plch2 APN 4 155043138 intron probably benign
IGL02580:Plch2 APN 4 154984764 missense probably benign 0.03
IGL03370:Plch2 APN 4 154986914 missense probably benign 0.18
IGL03407:Plch2 APN 4 154989798 missense probably damaging 1.00
tolerant UTSW 4 154984635 missense probably benign 0.01
PIT4418001:Plch2 UTSW 4 154989503 missense probably damaging 1.00
PIT4445001:Plch2 UTSW 4 155009026 missense probably damaging 1.00
R0117:Plch2 UTSW 4 154985358 unclassified probably benign
R0347:Plch2 UTSW 4 154986721 missense possibly damaging 0.91
R0361:Plch2 UTSW 4 155006711 missense possibly damaging 0.95
R0413:Plch2 UTSW 4 155006916 critical splice donor site probably null
R0487:Plch2 UTSW 4 155009012 missense probably damaging 1.00
R0514:Plch2 UTSW 4 154998886 missense probably damaging 1.00
R0734:Plch2 UTSW 4 154996283 missense probably damaging 1.00
R0766:Plch2 UTSW 4 154989799 missense probably damaging 1.00
R1306:Plch2 UTSW 4 155007140 missense probably damaging 1.00
R1312:Plch2 UTSW 4 154989799 missense probably damaging 1.00
R1467:Plch2 UTSW 4 154983732 missense probably benign 0.02
R1467:Plch2 UTSW 4 154983732 missense probably benign 0.02
R1602:Plch2 UTSW 4 154984450 missense probably damaging 0.99
R1717:Plch2 UTSW 4 154998272 missense probably benign
R1731:Plch2 UTSW 4 155006994 missense possibly damaging 0.83
R1769:Plch2 UTSW 4 155000083 missense probably damaging 1.00
R1875:Plch2 UTSW 4 154998508 missense probably damaging 1.00
R1974:Plch2 UTSW 4 154984953 missense possibly damaging 0.77
R2031:Plch2 UTSW 4 155043027 intron probably benign
R2050:Plch2 UTSW 4 155000818 missense probably benign 0.00
R2061:Plch2 UTSW 4 155042841 intron probably benign
R2073:Plch2 UTSW 4 154989909 missense probably damaging 1.00
R2075:Plch2 UTSW 4 154989909 missense probably damaging 1.00
R2109:Plch2 UTSW 4 154984597 missense possibly damaging 0.92
R2126:Plch2 UTSW 4 154998999 missense probably damaging 1.00
R2265:Plch2 UTSW 4 154993004 missense probably benign 0.06
R2266:Plch2 UTSW 4 154993004 missense probably benign 0.06
R2269:Plch2 UTSW 4 154993004 missense probably benign 0.06
R2280:Plch2 UTSW 4 154984309 missense probably damaging 1.00
R2281:Plch2 UTSW 4 154984309 missense probably damaging 1.00
R2432:Plch2 UTSW 4 154986164 makesense probably null
R2971:Plch2 UTSW 4 154990767 missense probably benign 0.29
R3437:Plch2 UTSW 4 154991013 critical splice donor site probably null
R3980:Plch2 UTSW 4 154984798 missense probably benign 0.00
R4757:Plch2 UTSW 4 154996233 missense possibly damaging 0.88
R4827:Plch2 UTSW 4 154991113 missense probably damaging 1.00
R4828:Plch2 UTSW 4 154984635 missense probably benign 0.01
R4869:Plch2 UTSW 4 154989428 missense probably benign 0.28
R5020:Plch2 UTSW 4 155007083 missense probably damaging 1.00
R5050:Plch2 UTSW 4 155043309 intron probably benign
R5126:Plch2 UTSW 4 155000519 missense probably damaging 1.00
R5237:Plch2 UTSW 4 155010794 missense probably benign
R5274:Plch2 UTSW 4 154998954 missense probably damaging 1.00
R5296:Plch2 UTSW 4 154989999 splice site probably null
R5324:Plch2 UTSW 4 154984534 missense probably benign
R5475:Plch2 UTSW 4 155000137 missense probably damaging 1.00
R5494:Plch2 UTSW 4 154991122 missense probably damaging 1.00
R5811:Plch2 UTSW 4 154992567 missense possibly damaging 0.62
R6083:Plch2 UTSW 4 155000818 missense probably benign 0.00
R6092:Plch2 UTSW 4 154984372 missense probably benign 0.02
R6253:Plch2 UTSW 4 155007101 missense probably damaging 1.00
R6456:Plch2 UTSW 4 154993002 missense probably damaging 1.00
R7038:Plch2 UTSW 4 154990032 splice site probably null
R7084:Plch2 UTSW 4 154986991 missense probably benign 0.31
R7210:Plch2 UTSW 4 155009086 missense probably damaging 1.00
R7216:Plch2 UTSW 4 154984228 missense probably benign
R7264:Plch2 UTSW 4 154998967 missense probably damaging 0.98
R7423:Plch2 UTSW 4 154983737 missense probably damaging 1.00
R7436:Plch2 UTSW 4 154984096 missense probably benign 0.01
R7438:Plch2 UTSW 4 155000460 missense probably damaging 1.00
R7594:Plch2 UTSW 4 155007027 missense probably damaging 1.00
R7663:Plch2 UTSW 4 154991162 missense probably damaging 0.96
R7698:Plch2 UTSW 4 155002787 missense possibly damaging 0.95
R7844:Plch2 UTSW 4 154989465 missense probably damaging 1.00
R7939:Plch2 UTSW 4 155002778 missense possibly damaging 0.91
R8003:Plch2 UTSW 4 155054523 missense unknown
R8007:Plch2 UTSW 4 155002831 missense probably damaging 1.00
R8281:Plch2 UTSW 4 155006973 missense probably benign 0.07
R8434:Plch2 UTSW 4 154989735 missense probably damaging 1.00
R8504:Plch2 UTSW 4 154984395 missense probably benign 0.31
R8516:Plch2 UTSW 4 154986307 missense probably benign
R8558:Plch2 UTSW 4 154998934 missense probably damaging 1.00
R8722:Plch2 UTSW 4 154985403 unclassified probably benign
R8768:Plch2 UTSW 4 154998867 missense probably damaging 1.00
R8787:Plch2 UTSW 4 154986418 missense probably benign 0.00
R8826:Plch2 UTSW 4 154986683 missense probably benign 0.00
R8955:Plch2 UTSW 4 154992566 missense probably benign 0.00
RF014:Plch2 UTSW 4 155007120 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCTCCTCACATCCATAGG -3'
(R):5'- ACAAAGGCCTCCTCCCTATG -3'

Sequencing Primer
(F):5'- TAAGGCTAGCCACCAAGGTCTG -3'
(R):5'- TCCTCCCTATGGCGGCC -3'
Posted On2019-06-26