Mutagenetix > Incidental Mutation

Incidental Mutation 'R7291:Polr1a'

566405

Institutional Source

Beutler Lab

Gene Symbol

Polr1a

Ensembl Gene

ENSMUSG00000049553

Gene Name

polymerase (RNA) I polypeptide A

Synonyms

RPA194, 3010014K16Rik, 194kDa, mRPA1, Rpo1-4

MMRRC Submission

Accession Numbers

Genbank: NM_009088; MGI: 1096397

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7291 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

71909053-71984935 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 71941456 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 666 (R666Q)

Ref Sequence

ENSEMBL: ENSMUSP00000060858 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055296] [ENSMUST00000206556]

AlphaFold

O35134

Predicted Effect

probably benign
Transcript: ENSMUST00000055296
AA Change: R666Q

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000060858
Gene: ENSMUSG00000049553
AA Change: R666Q

Domain	Start	End	E-Value	Type
RPOLA_N	302	649	8.97e-137	SMART
Pfam:RNA_pol_Rpb1_4	846	958	1.3e-26	PFAM
Pfam:RNA_pol_Rpb1_5	965	1669	7e-103	PFAM
low complexity region	1698	1708	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000206556

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the largest subunit of the RNA polymerase I complex. The encoded protein represents the catalytic subunit of the complex, which transcribes DNA into ribosomal RNA precursors. Defects in this gene are a cause of the Cincinnati type of acrofacial dysostosis. [provided by RefSeq, May 2016]

Allele List at MGI

All alleles(18) : Gene trapped(18)

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9430069I07Rik	T	C	15: 34,355,553	E51G	possibly damaging	Het
9530053A07Rik	A	C	7: 28,140,220	D486A	probably benign	Het
Abca14	C	A	7: 120,289,609	C1259*	probably null	Het
Ablim1	T	C	19: 57,215,908	E17G	probably benign	Het
Acsf3	G	A	8: 122,813,577	V505I	probably benign	Het
Actn1	T	C	12: 80,174,085	M650V	probably benign	Het
Adamts4	G	A	1: 171,256,528	V525I	probably benign	Het
Adh1	T	C	3: 138,282,808	Y181H	probably damaging	Het
Alpl	G	A	4: 137,752,698	R168W	probably damaging	Het
Ate1	T	G	7: 130,519,931	K11Q	probably benign	Het
Atpaf1	T	A	4: 115,811,091	F314L	probably damaging	Het
Baiap3	T	A	17: 25,244,317	D1004V	probably damaging	Het
Bpifb9a	C	T	2: 154,267,696	T504M	probably damaging	Het
C1s2	T	A	6: 124,625,384	I623F	probably benign	Het
Card11	T	C	5: 140,901,070	D308G	probably damaging	Het
Cul9	C	T	17: 46,540,433	V354I	probably benign	Het
Dnah1	A	T	14: 31,298,705	F1236I	probably damaging	Het
Dync2h1	T	A	9: 6,929,590	I4266F	possibly damaging	Het
Ear10	A	T	14: 43,922,920	V150D	probably damaging	Het
Elfn2	C	T	15: 78,672,983	A455T	probably benign	Het
Erp44	A	G	4: 48,208,792	Y223H	probably damaging	Het
Fam110b	T	A	4: 5,798,895	H104Q	probably benign	Het
Fcgbp	A	G	7: 28,101,392	N1288D	probably benign	Het
Fcrl1	T	C	3: 87,385,781		probably null	Het
Fmo2	G	T	1: 162,887,702	P117Q	probably benign	Het
Fsip2	A	G	2: 82,980,519	K2394R	possibly damaging	Het
Gab1	T	G	8: 80,800,151	K106T	probably damaging	Het
Gatad2b	T	C	3: 90,351,414	V248A	probably damaging	Het
Gemin6	T	C	17: 80,227,775	S55P	possibly damaging	Het
Gfm2	G	A	13: 97,175,024	V701I	probably benign	Het
Gm3250	T	C	10: 77,782,227	T106A	unknown	Het
Gm7356	T	C	17: 14,001,581	N62S	probably benign	Het
Gsdmc4	T	C	15: 63,902,840	T31A	possibly damaging	Het
H2-M10.1	T	A	17: 36,325,729	D61V	probably damaging	Het
Heatr5a	A	G	12: 51,925,339	L716S	probably damaging	Het
Hecw2	A	G	1: 53,914,594	Y831H	probably damaging	Het
Ifi202b	C	T	1: 173,974,815	S151N	probably benign	Het
Il15ra	C	T	2: 11,718,381	T72I	probably damaging	Het
Ints1	A	G	5: 139,765,074	L858P	probably damaging	Het
Kat2a	C	T	11: 100,710,900	V230I	possibly damaging	Het
Kcnq2	A	T	2: 181,088,379	I498N	possibly damaging	Het
Kif26b	C	T	1: 178,679,046	T229I	possibly damaging	Het
Ly75	T	A	2: 60,329,993	I957F	probably damaging	Het
Map3k12	T	A	15: 102,502,166	R459W	probably damaging	Het
Mia2	T	A	12: 59,158,369		probably null	Het
Mrgprf	A	G	7: 145,307,469	I53V	unknown	Het
Mttp	A	G	3: 138,091,203	L846P	probably damaging	Het
Myrip	C	T	9: 120,417,141	L112F	probably damaging	Het
Nav1	A	G	1: 135,465,859	F1047S	probably damaging	Het
Nfkbib	T	C	7: 28,759,203	D327G	possibly damaging	Het
Notch1	C	T	2: 26,476,375	V776I	probably benign	Het
Obsl1	G	T	1: 75,489,517	D1522E	probably damaging	Het
Olfr1464-ps1	A	T	19: 13,282,153	F302I	unknown	Het
Olfr605	T	A	7: 103,442,788	M112L	probably benign	Het
Olfr823	T	C	10: 130,112,224	K189E	probably benign	Het
Olfr859	T	C	9: 19,808,648	M110T	possibly damaging	Het
Pde7a	T	C	3: 19,227,674	N471D	probably benign	Het
Pla2r1	T	C	2: 60,530,435	H203R	probably benign	Het
Plch2	C	A	4: 154,998,472	C573F	probably damaging	Het
Prepl	T	C	17: 85,081,240	N145S	probably benign	Het
Psen2	C	T	1: 180,238,956	V139M	probably benign	Het
Ptgdr	A	T	14: 44,859,192	M21K	possibly damaging	Het
Rapgef6	T	C	11: 54,691,239	W1331R	probably benign	Het
Rp1l1	G	A	14: 64,032,298	G1778S	probably benign	Het
Rrbp1	A	T	2: 143,969,462	M824K	probably benign	Het
Sel1l	T	C	12: 91,848,965	T23A	probably benign	Het
Sele	A	G	1: 164,053,868	S515G	possibly damaging	Het
Slc22a23	T	C	13: 34,197,839	N421D	probably damaging	Het
Slc35f3	T	G	8: 126,394,558	L386R	probably benign	Het
Stab2	G	A	10: 86,946,220	S699L	probably damaging	Het
Synrg	A	T	11: 84,009,381	L726F	probably damaging	Het
Syt3	G	A	7: 44,395,919	V528M	probably damaging	Het
Szt2	A	G	4: 118,391,249	I655T	probably damaging	Het
Tbr1	T	C	2: 61,812,256	S622P	probably damaging	Het
Tex36	C	T	7: 133,587,223	G207S	probably benign	Het
Trav5n-4	G	A	14: 53,312,942	W13*	probably null	Het
Trdn	A	T	10: 33,437,736	E500V	probably null	Het
Ugt2b38	A	T	5: 87,411,895	N379K	probably damaging	Het
Unc13d	T	C	11: 116,074,050	R248G	possibly damaging	Het
Vmn1r195	C	T	13: 22,278,749	L130F	probably damaging	Het
Vmn2r110	T	C	17: 20,574,209	I733V	probably benign	Het
Zfp870	T	A	17: 32,883,854	N167I	probably damaging	Het
Zmynd10	A	T	9: 107,549,304	M179L	probably benign	Het

Other mutations in Polr1a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01363:Polr1a	APN	6	71948486	missense	probably benign	0.32
IGL01834:Polr1a	APN	6	71948462	missense	probably benign
IGL01902:Polr1a	APN	6	71963748	missense	probably damaging	1.00
IGL02101:Polr1a	APN	6	71950802	missense	probably benign	0.00
IGL02325:Polr1a	APN	6	71920657	missense	probably benign	0.38
IGL02398:Polr1a	APN	6	71936556	splice site	probably benign
IGL02528:Polr1a	APN	6	71964717	missense	probably benign
IGL02555:Polr1a	APN	6	71920457	missense	probably damaging	0.98
IGL02613:Polr1a	APN	6	71967320	missense	probably damaging	1.00
IGL02693:Polr1a	APN	6	71963846	splice site	probably benign
IGL02892:Polr1a	APN	6	71931696	missense	possibly damaging	0.70
IGL03059:Polr1a	APN	6	71936512	missense	probably benign
IGL03174:Polr1a	APN	6	71977347	missense	possibly damaging	0.82
D4043:Polr1a	UTSW	6	71941417	missense	possibly damaging	0.92
R0092:Polr1a	UTSW	6	71967455	splice site	probably benign
R0217:Polr1a	UTSW	6	71963703	missense	probably benign	0.19
R0267:Polr1a	UTSW	6	71974139	missense	probably damaging	0.99
R0329:Polr1a	UTSW	6	71966416	missense	possibly damaging	0.96
R0330:Polr1a	UTSW	6	71966416	missense	possibly damaging	0.96
R0352:Polr1a	UTSW	6	71920763	splice site	probably benign
R0411:Polr1a	UTSW	6	71978421	missense	possibly damaging	0.95
R0446:Polr1a	UTSW	6	71950664	critical splice donor site	probably null
R0846:Polr1a	UTSW	6	71924643	missense	probably damaging	1.00
R1035:Polr1a	UTSW	6	71967916	missense	probably benign
R1294:Polr1a	UTSW	6	71912902	missense	probably damaging	0.99
R1460:Polr1a	UTSW	6	71941384	missense	probably damaging	0.99
R1657:Polr1a	UTSW	6	71941535	missense	probably damaging	1.00
R1846:Polr1a	UTSW	6	71976188	missense	probably damaging	0.98
R1862:Polr1a	UTSW	6	71909203	missense	probably damaging	0.96
R1865:Polr1a	UTSW	6	71966524	missense	probably damaging	1.00
R1903:Polr1a	UTSW	6	71967914	missense	probably benign	0.02
R1937:Polr1a	UTSW	6	71936552	critical splice donor site	probably null
R2063:Polr1a	UTSW	6	71936285	splice site	probably null
R2071:Polr1a	UTSW	6	71976074	missense	possibly damaging	0.64
R2084:Polr1a	UTSW	6	71950809	missense	possibly damaging	0.69
R2377:Polr1a	UTSW	6	71972826	critical splice donor site	probably null
R2410:Polr1a	UTSW	6	71974882	missense	probably benign
R3001:Polr1a	UTSW	6	71965644	missense	probably benign	0.02
R3001:Polr1a	UTSW	6	71913016	missense	probably benign	0.01
R3002:Polr1a	UTSW	6	71913016	missense	probably benign	0.01
R3002:Polr1a	UTSW	6	71965644	missense	probably benign	0.02
R3924:Polr1a	UTSW	6	71929450	missense	probably benign	0.00
R4105:Polr1a	UTSW	6	71976191	missense	probably damaging	0.98
R4125:Polr1a	UTSW	6	71965706	missense	probably benign	0.00
R4271:Polr1a	UTSW	6	71953022	missense	probably benign	0.02
R4440:Polr1a	UTSW	6	71950848	missense	probably damaging	0.98
R4667:Polr1a	UTSW	6	71917821	missense	probably benign	0.30
R4769:Polr1a	UTSW	6	71950868	missense	probably benign	0.01
R4801:Polr1a	UTSW	6	71976070	missense	probably benign	0.00
R4802:Polr1a	UTSW	6	71976070	missense	probably benign	0.00
R4828:Polr1a	UTSW	6	71966401	missense	possibly damaging	0.93
R4911:Polr1a	UTSW	6	71909229	missense	possibly damaging	0.67
R5071:Polr1a	UTSW	6	71931709	missense	possibly damaging	0.71
R5165:Polr1a	UTSW	6	71967925	missense	probably damaging	1.00
R5223:Polr1a	UTSW	6	71967907	missense	possibly damaging	0.73
R5239:Polr1a	UTSW	6	71913037	missense	probably damaging	1.00
R5546:Polr1a	UTSW	6	71929366	missense	possibly damaging	0.64
R5599:Polr1a	UTSW	6	71967362	missense	possibly damaging	0.95
R5696:Polr1a	UTSW	6	71929426	missense	probably benign	0.05
R5850:Polr1a	UTSW	6	71926683	missense	probably benign	0.00
R6274:Polr1a	UTSW	6	71954890	splice site	probably null
R6526:Polr1a	UTSW	6	71929443	missense	possibly damaging	0.89
R6578:Polr1a	UTSW	6	71976041	missense	possibly damaging	0.93
R6660:Polr1a	UTSW	6	71967374	missense	probably damaging	0.98
R6892:Polr1a	UTSW	6	71964712	missense	possibly damaging	0.72
R7274:Polr1a	UTSW	6	71920516	nonsense	probably null
R7311:Polr1a	UTSW	6	71950879	missense	possibly damaging	0.53
R7431:Polr1a	UTSW	6	71926659	missense	probably benign	0.14
R7479:Polr1a	UTSW	6	71936297	missense	probably damaging	1.00
R7607:Polr1a	UTSW	6	71913021	missense	probably benign
R7739:Polr1a	UTSW	6	71954835	missense	possibly damaging	0.94
R7746:Polr1a	UTSW	6	71941512	missense	probably damaging	1.00
R7764:Polr1a	UTSW	6	71953070	missense	probably damaging	1.00
R7835:Polr1a	UTSW	6	71915142	missense	probably benign	0.02
R8029:Polr1a	UTSW	6	71912956	nonsense	probably null
R8057:Polr1a	UTSW	6	71931660	missense	possibly damaging	0.95
R8144:Polr1a	UTSW	6	71950616	missense	probably benign
R8170:Polr1a	UTSW	6	71920749	missense	probably benign
R8320:Polr1a	UTSW	6	71941384	missense	probably damaging	0.99
R8328:Polr1a	UTSW	6	71920734	missense	probably benign
R8331:Polr1a	UTSW	6	71976179	missense	probably damaging	1.00
R8362:Polr1a	UTSW	6	71964667	missense	probably benign	0.00
R8511:Polr1a	UTSW	6	71920520	missense	probably benign	0.01
R8709:Polr1a	UTSW	6	71974848	missense	probably benign
R8745:Polr1a	UTSW	6	71954771	missense	probably damaging	1.00
R8784:Polr1a	UTSW	6	71950628	missense	probably benign
R9055:Polr1a	UTSW	6	71915069	missense	possibly damaging	0.46
R9088:Polr1a	UTSW	6	71931783	missense	probably benign	0.26
R9211:Polr1a	UTSW	6	71966537	missense	probably damaging	1.00
R9228:Polr1a	UTSW	6	71954771	missense	probably damaging	1.00
R9240:Polr1a	UTSW	6	71963677	nonsense	probably null
R9267:Polr1a	UTSW	6	71965558	missense	probably benign
R9302:Polr1a	UTSW	6	71924699	critical splice donor site	probably null
R9744:Polr1a	UTSW	6	71929388	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- CCGAGAGTTTGGGCTTTATCC -3'
(R):5'- CTCTGGTCTAGGATCTCTTAGAAC -3'

Sequencing Primer
(F):5'- TGGCCTCCAAGCAGATGGTTAG -3'
(R):5'- GTCTAGGATCTCTTAGAACAGTTTTG -3'

Posted On

2019-06-26