Mutagenetix > Incidental Mutation

Incidental Mutation 'R7291:Gab1'

566416

Institutional Source

Beutler Lab

Gene Symbol

Gab1

Ensembl Gene

ENSMUSG00000031714

Gene Name

growth factor receptor bound protein 2-associated protein 1

Synonyms

MMRRC Submission

Accession Numbers

Genbank: NM_021356; MGI: 108088

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7291 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

80764438-80880519 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 80800151 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Threonine at position 106 (K106T)

Ref Sequence

ENSEMBL: ENSMUSP00000147784 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034150] [ENSMUST00000210676]

AlphaFold

Q9QYY0

Predicted Effect

probably damaging
Transcript: ENSMUST00000034150
AA Change: K106T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000034150
Gene: ENSMUSG00000031714
AA Change: K106T

Domain	Start	End	E-Value	Type
PH	6	118	1.16e-23	SMART
low complexity region	336	354	N/A	INTRINSIC
low complexity region	572	586	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000210676
AA Change: K106T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the IRS1-like multisubstrate docking protein family. It is an important mediator of branching tubulogenesis and plays a central role in cellular growth response, transformation and apoptosis. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit developmental defects in the placenta, heart, eye, muscle, and skin, and die between embryonic day 13.5 and 18.5. [provided by MGI curators]

Allele List at MGI

All alleles(43) : Targeted, knock-out(1) Targeted, other(8) Gene trapped(34)

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9430069I07Rik	T	C	15: 34,355,553	E51G	possibly damaging	Het
9530053A07Rik	A	C	7: 28,140,220	D486A	probably benign	Het
Abca14	C	A	7: 120,289,609	C1259*	probably null	Het
Ablim1	T	C	19: 57,215,908	E17G	probably benign	Het
Acsf3	G	A	8: 122,813,577	V505I	probably benign	Het
Actn1	T	C	12: 80,174,085	M650V	probably benign	Het
Adamts4	G	A	1: 171,256,528	V525I	probably benign	Het
Adh1	T	C	3: 138,282,808	Y181H	probably damaging	Het
Alpl	G	A	4: 137,752,698	R168W	probably damaging	Het
Ate1	T	G	7: 130,519,931	K11Q	probably benign	Het
Atpaf1	T	A	4: 115,811,091	F314L	probably damaging	Het
Baiap3	T	A	17: 25,244,317	D1004V	probably damaging	Het
Bpifb9a	C	T	2: 154,267,696	T504M	probably damaging	Het
C1s2	T	A	6: 124,625,384	I623F	probably benign	Het
Card11	T	C	5: 140,901,070	D308G	probably damaging	Het
Cul9	C	T	17: 46,540,433	V354I	probably benign	Het
Dnah1	A	T	14: 31,298,705	F1236I	probably damaging	Het
Dync2h1	T	A	9: 6,929,590	I4266F	possibly damaging	Het
Ear10	A	T	14: 43,922,920	V150D	probably damaging	Het
Elfn2	C	T	15: 78,672,983	A455T	probably benign	Het
Erp44	A	G	4: 48,208,792	Y223H	probably damaging	Het
Fam110b	T	A	4: 5,798,895	H104Q	probably benign	Het
Fcgbp	A	G	7: 28,101,392	N1288D	probably benign	Het
Fcrl1	T	C	3: 87,385,781		probably null	Het
Fmo2	G	T	1: 162,887,702	P117Q	probably benign	Het
Fsip2	A	G	2: 82,980,519	K2394R	possibly damaging	Het
Gatad2b	T	C	3: 90,351,414	V248A	probably damaging	Het
Gemin6	T	C	17: 80,227,775	S55P	possibly damaging	Het
Gfm2	G	A	13: 97,175,024	V701I	probably benign	Het
Gm3250	T	C	10: 77,782,227	T106A	unknown	Het
Gm7356	T	C	17: 14,001,581	N62S	probably benign	Het
Gsdmc4	T	C	15: 63,902,840	T31A	possibly damaging	Het
H2-M10.1	T	A	17: 36,325,729	D61V	probably damaging	Het
Heatr5a	A	G	12: 51,925,339	L716S	probably damaging	Het
Hecw2	A	G	1: 53,914,594	Y831H	probably damaging	Het
Ifi202b	C	T	1: 173,974,815	S151N	probably benign	Het
Il15ra	C	T	2: 11,718,381	T72I	probably damaging	Het
Ints1	A	G	5: 139,765,074	L858P	probably damaging	Het
Kat2a	C	T	11: 100,710,900	V230I	possibly damaging	Het
Kcnq2	A	T	2: 181,088,379	I498N	possibly damaging	Het
Kif26b	C	T	1: 178,679,046	T229I	possibly damaging	Het
Ly75	T	A	2: 60,329,993	I957F	probably damaging	Het
Map3k12	T	A	15: 102,502,166	R459W	probably damaging	Het
Mia2	T	A	12: 59,158,369		probably null	Het
Mrgprf	A	G	7: 145,307,469	I53V	unknown	Het
Mttp	A	G	3: 138,091,203	L846P	probably damaging	Het
Myrip	C	T	9: 120,417,141	L112F	probably damaging	Het
Nav1	A	G	1: 135,465,859	F1047S	probably damaging	Het
Nfkbib	T	C	7: 28,759,203	D327G	possibly damaging	Het
Notch1	C	T	2: 26,476,375	V776I	probably benign	Het
Obsl1	G	T	1: 75,489,517	D1522E	probably damaging	Het
Olfr1464-ps1	A	T	19: 13,282,153	F302I	unknown	Het
Olfr605	T	A	7: 103,442,788	M112L	probably benign	Het
Olfr823	T	C	10: 130,112,224	K189E	probably benign	Het
Olfr859	T	C	9: 19,808,648	M110T	possibly damaging	Het
Pde7a	T	C	3: 19,227,674	N471D	probably benign	Het
Pla2r1	T	C	2: 60,530,435	H203R	probably benign	Het
Plch2	C	A	4: 154,998,472	C573F	probably damaging	Het
Polr1a	G	A	6: 71,941,456	R666Q	probably benign	Het
Prepl	T	C	17: 85,081,240	N145S	probably benign	Het
Psen2	C	T	1: 180,238,956	V139M	probably benign	Het
Ptgdr	A	T	14: 44,859,192	M21K	possibly damaging	Het
Rapgef6	T	C	11: 54,691,239	W1331R	probably benign	Het
Rp1l1	G	A	14: 64,032,298	G1778S	probably benign	Het
Rrbp1	A	T	2: 143,969,462	M824K	probably benign	Het
Sel1l	T	C	12: 91,848,965	T23A	probably benign	Het
Sele	A	G	1: 164,053,868	S515G	possibly damaging	Het
Slc22a23	T	C	13: 34,197,839	N421D	probably damaging	Het
Slc35f3	T	G	8: 126,394,558	L386R	probably benign	Het
Stab2	G	A	10: 86,946,220	S699L	probably damaging	Het
Synrg	A	T	11: 84,009,381	L726F	probably damaging	Het
Syt3	G	A	7: 44,395,919	V528M	probably damaging	Het
Szt2	A	G	4: 118,391,249	I655T	probably damaging	Het
Tbr1	T	C	2: 61,812,256	S622P	probably damaging	Het
Tex36	C	T	7: 133,587,223	G207S	probably benign	Het
Trav5n-4	G	A	14: 53,312,942	W13*	probably null	Het
Trdn	A	T	10: 33,437,736	E500V	probably null	Het
Ugt2b38	A	T	5: 87,411,895	N379K	probably damaging	Het
Unc13d	T	C	11: 116,074,050	R248G	possibly damaging	Het
Vmn1r195	C	T	13: 22,278,749	L130F	probably damaging	Het
Vmn2r110	T	C	17: 20,574,209	I733V	probably benign	Het
Zfp870	T	A	17: 32,883,854	N167I	probably damaging	Het
Zmynd10	A	T	9: 107,549,304	M179L	probably benign	Het

Other mutations in Gab1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01679:Gab1	APN	8	80791549	missense	probably benign	0.00
IGL02610:Gab1	APN	8	80800099	critical splice donor site	probably null
IGL02661:Gab1	APN	8	80788937	missense	probably damaging	1.00
IGL02716:Gab1	APN	8	80769694	missense	probably damaging	1.00
fallen_angel	UTSW	8	80879532	nonsense	probably null
fleabite	UTSW	8	80800116	missense	probably damaging	1.00
Welterweight	UTSW	8	80774965	nonsense	probably null
D3080:Gab1	UTSW	8	80766378	missense	probably damaging	1.00
R0006:Gab1	UTSW	8	80769730	missense	possibly damaging	0.56
R0144:Gab1	UTSW	8	80785201	splice site	probably benign
R0173:Gab1	UTSW	8	80800160	missense	possibly damaging	0.68
R0414:Gab1	UTSW	8	80800289	missense	probably damaging	1.00
R0503:Gab1	UTSW	8	80800142	missense	probably damaging	1.00
R0675:Gab1	UTSW	8	80769668	missense	probably damaging	1.00
R0690:Gab1	UTSW	8	80800116	missense	probably damaging	1.00
R1068:Gab1	UTSW	8	80800172	missense	possibly damaging	0.95
R1175:Gab1	UTSW	8	80784842	missense	probably damaging	0.99
R1240:Gab1	UTSW	8	80788530	missense	probably damaging	1.00
R1430:Gab1	UTSW	8	80788612	missense	probably benign	0.34
R1656:Gab1	UTSW	8	80788759	missense	probably damaging	1.00
R1986:Gab1	UTSW	8	80766381	missense	probably damaging	1.00
R2860:Gab1	UTSW	8	80784753	missense	probably benign	0.32
R2861:Gab1	UTSW	8	80784753	missense	probably benign	0.32
R4683:Gab1	UTSW	8	80788632	missense	probably benign	0.34
R4726:Gab1	UTSW	8	80789053	missense	possibly damaging	0.80
R5425:Gab1	UTSW	8	80800389	missense	probably damaging	1.00
R5684:Gab1	UTSW	8	80769670	missense	probably damaging	1.00
R6195:Gab1	UTSW	8	80879532	nonsense	probably null
R6217:Gab1	UTSW	8	80791608	missense	possibly damaging	0.48
R6233:Gab1	UTSW	8	80879532	nonsense	probably null
R6407:Gab1	UTSW	8	80788597	missense	possibly damaging	0.77
R6408:Gab1	UTSW	8	80788597	missense	possibly damaging	0.77
R6415:Gab1	UTSW	8	80788597	missense	possibly damaging	0.77
R6418:Gab1	UTSW	8	80788597	missense	possibly damaging	0.77
R6479:Gab1	UTSW	8	80788597	missense	possibly damaging	0.77
R7019:Gab1	UTSW	8	80784817	missense	probably damaging	0.99
R7432:Gab1	UTSW	8	80788669	missense	probably benign	0.20
R7875:Gab1	UTSW	8	80788766	missense	probably damaging	1.00
R7893:Gab1	UTSW	8	80784766	missense	possibly damaging	0.47
R8405:Gab1	UTSW	8	80774965	nonsense	probably null
R9105:Gab1	UTSW	8	80788960	missense	probably damaging	1.00
R9485:Gab1	UTSW	8	80788855	missense	probably damaging	0.99
X0066:Gab1	UTSW	8	80879564	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TTCAGTGCCTGCTCAAAATGTC -3'
(R):5'- TTTGACTGGAGACCCGGATG -3'

Sequencing Primer
(F):5'- AACCTTAAACTCTGGGTCTGGAG -3'
(R):5'- ACCCGGATGTCCTGGAGTATTAC -3'

Posted On

2019-06-26