Incidental Mutation 'R7291:Slc35f3'
ID 566418
Institutional Source Beutler Lab
Gene Symbol Slc35f3
Ensembl Gene ENSMUSG00000057060
Gene Name solute carrier family 35, member F3
Synonyms B230375D17Rik
MMRRC Submission 045322-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.160) question?
Stock # R7291 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 126865734-127122717 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 127121297 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Arginine at position 386 (L386R)
Ref Sequence ENSEMBL: ENSMUSP00000104390 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108759]
AlphaFold Q1LZI2
Predicted Effect probably benign
Transcript: ENSMUST00000108759
AA Change: L386R

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000104390
Gene: ENSMUSG00000057060
AA Change: L386R

DomainStartEndE-ValueType
low complexity region 25 49 N/A INTRINSIC
Pfam:EamA 67 223 3.2e-7 PFAM
Pfam:SLC35F 145 374 3.2e-6 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430069I07Rik T C 15: 34,355,699 (GRCm39) E51G possibly damaging Het
Abca14 C A 7: 119,888,832 (GRCm39) C1259* probably null Het
Ablim1 T C 19: 57,204,340 (GRCm39) E17G probably benign Het
Acsf3 G A 8: 123,540,316 (GRCm39) V505I probably benign Het
Actn1 T C 12: 80,220,859 (GRCm39) M650V probably benign Het
Adamts4 G A 1: 171,084,097 (GRCm39) V525I probably benign Het
Adh1 T C 3: 137,988,569 (GRCm39) Y181H probably damaging Het
Alpl G A 4: 137,480,009 (GRCm39) R168W probably damaging Het
Ate1 T G 7: 130,121,661 (GRCm39) K11Q probably benign Het
Atpaf1 T A 4: 115,668,288 (GRCm39) F314L probably damaging Het
Baiap3 T A 17: 25,463,291 (GRCm39) D1004V probably damaging Het
Bpifb9a C T 2: 154,109,616 (GRCm39) T504M probably damaging Het
C1s2 T A 6: 124,602,343 (GRCm39) I623F probably benign Het
Card11 T C 5: 140,886,825 (GRCm39) D308G probably damaging Het
Cul9 C T 17: 46,851,359 (GRCm39) V354I probably benign Het
Dnah1 A T 14: 31,020,662 (GRCm39) F1236I probably damaging Het
Dync2h1 T A 9: 6,929,590 (GRCm39) I4266F possibly damaging Het
Ear10 A T 14: 44,160,377 (GRCm39) V150D probably damaging Het
Elfn2 C T 15: 78,557,183 (GRCm39) A455T probably benign Het
Erp44 A G 4: 48,208,792 (GRCm39) Y223H probably damaging Het
Fam110b T A 4: 5,798,895 (GRCm39) H104Q probably benign Het
Fcgbp A G 7: 27,800,817 (GRCm39) N1288D probably benign Het
Fcgbpl1 A C 7: 27,839,645 (GRCm39) D486A probably benign Het
Fcrl1 T C 3: 87,293,088 (GRCm39) probably null Het
Fmo2 G T 1: 162,715,271 (GRCm39) P117Q probably benign Het
Fsip2 A G 2: 82,810,863 (GRCm39) K2394R possibly damaging Het
Gab1 T G 8: 81,526,780 (GRCm39) K106T probably damaging Het
Gatad2b T C 3: 90,258,721 (GRCm39) V248A probably damaging Het
Gemin6 T C 17: 80,535,204 (GRCm39) S55P possibly damaging Het
Gfm2 G A 13: 97,311,532 (GRCm39) V701I probably benign Het
Gm3250 T C 10: 77,618,061 (GRCm39) T106A unknown Het
Gm7356 T C 17: 14,221,843 (GRCm39) N62S probably benign Het
Gsdmc4 T C 15: 63,774,689 (GRCm39) T31A possibly damaging Het
H2-M10.1 T A 17: 36,636,621 (GRCm39) D61V probably damaging Het
Heatr5a A G 12: 51,972,122 (GRCm39) L716S probably damaging Het
Hecw2 A G 1: 53,953,753 (GRCm39) Y831H probably damaging Het
Ifi202b C T 1: 173,802,381 (GRCm39) S151N probably benign Het
Il15ra C T 2: 11,723,192 (GRCm39) T72I probably damaging Het
Ints1 A G 5: 139,750,829 (GRCm39) L858P probably damaging Het
Kat2a C T 11: 100,601,726 (GRCm39) V230I possibly damaging Het
Kcnq2 A T 2: 180,730,172 (GRCm39) I498N possibly damaging Het
Kif26b C T 1: 178,506,611 (GRCm39) T229I possibly damaging Het
Ly75 T A 2: 60,160,337 (GRCm39) I957F probably damaging Het
Map3k12 T A 15: 102,410,601 (GRCm39) R459W probably damaging Het
Mia2 T A 12: 59,205,155 (GRCm39) probably null Het
Mrgprf A G 7: 144,861,206 (GRCm39) I53V unknown Het
Mttp A G 3: 137,796,964 (GRCm39) L846P probably damaging Het
Myrip C T 9: 120,246,207 (GRCm39) L112F probably damaging Het
Nav1 A G 1: 135,393,597 (GRCm39) F1047S probably damaging Het
Nfkbib T C 7: 28,458,628 (GRCm39) D327G possibly damaging Het
Notch1 C T 2: 26,366,387 (GRCm39) V776I probably benign Het
Obsl1 G T 1: 75,466,161 (GRCm39) D1522E probably damaging Het
Or52s6 T A 7: 103,091,995 (GRCm39) M112L probably benign Het
Or5b110-ps1 A T 19: 13,259,517 (GRCm39) F302I unknown Het
Or7e168 T C 9: 19,719,944 (GRCm39) M110T possibly damaging Het
Or9r3 T C 10: 129,948,093 (GRCm39) K189E probably benign Het
Pde7a T C 3: 19,281,838 (GRCm39) N471D probably benign Het
Pla2r1 T C 2: 60,360,779 (GRCm39) H203R probably benign Het
Plch2 C A 4: 155,082,929 (GRCm39) C573F probably damaging Het
Polr1a G A 6: 71,918,440 (GRCm39) R666Q probably benign Het
Prepl T C 17: 85,388,668 (GRCm39) N145S probably benign Het
Psen2 C T 1: 180,066,521 (GRCm39) V139M probably benign Het
Ptgdr A T 14: 45,096,649 (GRCm39) M21K possibly damaging Het
Rapgef6 T C 11: 54,582,065 (GRCm39) W1331R probably benign Het
Rp1l1 G A 14: 64,269,747 (GRCm39) G1778S probably benign Het
Rrbp1 A T 2: 143,811,382 (GRCm39) M824K probably benign Het
Sel1l T C 12: 91,815,739 (GRCm39) T23A probably benign Het
Sele A G 1: 163,881,437 (GRCm39) S515G possibly damaging Het
Slc22a23 T C 13: 34,381,822 (GRCm39) N421D probably damaging Het
Stab2 G A 10: 86,782,084 (GRCm39) S699L probably damaging Het
Synrg A T 11: 83,900,207 (GRCm39) L726F probably damaging Het
Syt3 G A 7: 44,045,343 (GRCm39) V528M probably damaging Het
Szt2 A G 4: 118,248,446 (GRCm39) I655T probably damaging Het
Tbr1 T C 2: 61,642,600 (GRCm39) S622P probably damaging Het
Tex36 C T 7: 133,188,952 (GRCm39) G207S probably benign Het
Trav5n-4 G A 14: 53,550,399 (GRCm39) W13* probably null Het
Trdn A T 10: 33,313,732 (GRCm39) E500V probably null Het
Ugt2b38 A T 5: 87,559,754 (GRCm39) N379K probably damaging Het
Unc13d T C 11: 115,964,876 (GRCm39) R248G possibly damaging Het
Vmn1r195 C T 13: 22,462,919 (GRCm39) L130F probably damaging Het
Vmn2r110 T C 17: 20,794,471 (GRCm39) I733V probably benign Het
Zfp870 T A 17: 33,102,828 (GRCm39) N167I probably damaging Het
Zmynd10 A T 9: 107,426,503 (GRCm39) M179L probably benign Het
Other mutations in Slc35f3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00687:Slc35f3 APN 8 127,108,903 (GRCm39) missense probably benign 0.02
IGL00956:Slc35f3 APN 8 127,108,963 (GRCm39) missense probably damaging 1.00
IGL01105:Slc35f3 APN 8 127,025,553 (GRCm39) missense probably damaging 1.00
IGL01710:Slc35f3 APN 8 127,115,900 (GRCm39) missense probably benign 0.00
IGL01771:Slc35f3 APN 8 127,115,951 (GRCm39) missense probably benign 0.00
IGL02254:Slc35f3 APN 8 127,115,862 (GRCm39) missense probably damaging 1.00
IGL02610:Slc35f3 APN 8 127,047,956 (GRCm39) missense probably damaging 1.00
R1666:Slc35f3 UTSW 8 127,115,960 (GRCm39) missense probably damaging 0.98
R2510:Slc35f3 UTSW 8 127,025,445 (GRCm39) start gained probably benign
R2520:Slc35f3 UTSW 8 127,121,312 (GRCm39) missense possibly damaging 0.81
R3807:Slc35f3 UTSW 8 127,115,978 (GRCm39) missense probably damaging 1.00
R4644:Slc35f3 UTSW 8 127,047,809 (GRCm39) missense possibly damaging 0.87
R4675:Slc35f3 UTSW 8 127,047,935 (GRCm39) nonsense probably null
R4976:Slc35f3 UTSW 8 127,116,020 (GRCm39) splice site probably null
R5037:Slc35f3 UTSW 8 127,116,011 (GRCm39) missense probably damaging 0.99
R5225:Slc35f3 UTSW 8 127,117,846 (GRCm39) missense probably damaging 0.98
R5259:Slc35f3 UTSW 8 127,115,872 (GRCm39) missense probably damaging 1.00
R5856:Slc35f3 UTSW 8 127,047,819 (GRCm39) missense probably benign 0.07
R5925:Slc35f3 UTSW 8 127,115,946 (GRCm39) missense probably benign 0.24
R6254:Slc35f3 UTSW 8 127,047,833 (GRCm39) missense possibly damaging 0.96
R6748:Slc35f3 UTSW 8 127,121,377 (GRCm39) nonsense probably null
R6785:Slc35f3 UTSW 8 127,121,198 (GRCm39) missense probably benign 0.02
R7002:Slc35f3 UTSW 8 127,115,773 (GRCm39) critical splice acceptor site unknown
R7411:Slc35f3 UTSW 8 127,115,777 (GRCm39) critical splice acceptor site probably benign
R7456:Slc35f3 UTSW 8 127,115,779 (GRCm39) critical splice acceptor site unknown
R7790:Slc35f3 UTSW 8 127,115,777 (GRCm39) critical splice acceptor site probably benign
R7852:Slc35f3 UTSW 8 127,121,219 (GRCm39) missense probably damaging 1.00
R8000:Slc35f3 UTSW 8 127,047,812 (GRCm39) missense probably benign
R8277:Slc35f3 UTSW 8 127,115,925 (GRCm39) missense possibly damaging 0.88
R8827:Slc35f3 UTSW 8 127,115,780 (GRCm39) critical splice acceptor site probably benign
R8983:Slc35f3 UTSW 8 127,115,775 (GRCm39) critical splice acceptor site probably benign
R9205:Slc35f3 UTSW 8 127,115,928 (GRCm39) missense probably damaging 0.96
R9355:Slc35f3 UTSW 8 127,108,967 (GRCm39) missense probably damaging 0.97
R9475:Slc35f3 UTSW 8 127,108,993 (GRCm39) missense probably damaging 1.00
R9492:Slc35f3 UTSW 8 127,048,026 (GRCm39) missense probably damaging 1.00
R9714:Slc35f3 UTSW 8 127,115,781 (GRCm39) critical splice acceptor site probably benign
R9729:Slc35f3 UTSW 8 127,115,777 (GRCm39) critical splice acceptor site probably benign
R9769:Slc35f3 UTSW 8 127,121,336 (GRCm39) missense probably damaging 0.99
X0067:Slc35f3 UTSW 8 127,109,062 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTATCTCCACGTCCACAGACTG -3'
(R):5'- CCGTAGAACTTACTGCAGTTACC -3'

Sequencing Primer
(F):5'- TCCACAGACTGAGTAACCGGTG -3'
(R):5'- AACTGAGGTTCCTCCATCAGG -3'
Posted On 2019-06-26