Incidental Mutation 'R7291:Trdn'
ID 566423
Institutional Source Beutler Lab
Gene Symbol Trdn
Ensembl Gene ENSMUSG00000019787
Gene Name triadin
Synonyms triadin 2, triadin 1, 2310045H21Rik, EG432451, triadin-2, triadin-3, triadin-1, triadin 3
MMRRC Submission 045322-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.066) question?
Stock # R7291 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 32959479-33352705 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 33313732 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Valine at position 500 (E500V)
Ref Sequence ENSEMBL: ENSMUSP00000093436 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095762]
AlphaFold E9Q9K5
Predicted Effect probably null
Transcript: ENSMUST00000095762
AA Change: E500V

PolyPhen 2 Score 0.826 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000093436
Gene: ENSMUSG00000019787
AA Change: E500V

DomainStartEndE-ValueType
SCOP:d1lnqa2 49 116 1e-4 SMART
low complexity region 147 158 N/A INTRINSIC
low complexity region 166 182 N/A INTRINSIC
low complexity region 198 223 N/A INTRINSIC
low complexity region 229 250 N/A INTRINSIC
coiled coil region 306 333 N/A INTRINSIC
low complexity region 342 352 N/A INTRINSIC
low complexity region 380 396 N/A INTRINSIC
coiled coil region 417 437 N/A INTRINSIC
low complexity region 448 484 N/A INTRINSIC
low complexity region 539 551 N/A INTRINSIC
low complexity region 559 572 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein that contains a single transmembrane domain. As similar protein in rabbits plays a role in skeletal muscle excitation-contraction coupling as part of the calcium release complex in association with the ryanodine receptor. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and single nucleotide polymorphisms in this gene may be markers for IgA nephritis. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit a loss of transverse orientation of triads within skeletal muscle cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430069I07Rik T C 15: 34,355,699 (GRCm39) E51G possibly damaging Het
Abca14 C A 7: 119,888,832 (GRCm39) C1259* probably null Het
Ablim1 T C 19: 57,204,340 (GRCm39) E17G probably benign Het
Acsf3 G A 8: 123,540,316 (GRCm39) V505I probably benign Het
Actn1 T C 12: 80,220,859 (GRCm39) M650V probably benign Het
Adamts4 G A 1: 171,084,097 (GRCm39) V525I probably benign Het
Adh1 T C 3: 137,988,569 (GRCm39) Y181H probably damaging Het
Alpl G A 4: 137,480,009 (GRCm39) R168W probably damaging Het
Ate1 T G 7: 130,121,661 (GRCm39) K11Q probably benign Het
Atpaf1 T A 4: 115,668,288 (GRCm39) F314L probably damaging Het
Baiap3 T A 17: 25,463,291 (GRCm39) D1004V probably damaging Het
Bpifb9a C T 2: 154,109,616 (GRCm39) T504M probably damaging Het
C1s2 T A 6: 124,602,343 (GRCm39) I623F probably benign Het
Card11 T C 5: 140,886,825 (GRCm39) D308G probably damaging Het
Cul9 C T 17: 46,851,359 (GRCm39) V354I probably benign Het
Dnah1 A T 14: 31,020,662 (GRCm39) F1236I probably damaging Het
Dync2h1 T A 9: 6,929,590 (GRCm39) I4266F possibly damaging Het
Ear10 A T 14: 44,160,377 (GRCm39) V150D probably damaging Het
Elfn2 C T 15: 78,557,183 (GRCm39) A455T probably benign Het
Erp44 A G 4: 48,208,792 (GRCm39) Y223H probably damaging Het
Fam110b T A 4: 5,798,895 (GRCm39) H104Q probably benign Het
Fcgbp A G 7: 27,800,817 (GRCm39) N1288D probably benign Het
Fcgbpl1 A C 7: 27,839,645 (GRCm39) D486A probably benign Het
Fcrl1 T C 3: 87,293,088 (GRCm39) probably null Het
Fmo2 G T 1: 162,715,271 (GRCm39) P117Q probably benign Het
Fsip2 A G 2: 82,810,863 (GRCm39) K2394R possibly damaging Het
Gab1 T G 8: 81,526,780 (GRCm39) K106T probably damaging Het
Gatad2b T C 3: 90,258,721 (GRCm39) V248A probably damaging Het
Gemin6 T C 17: 80,535,204 (GRCm39) S55P possibly damaging Het
Gfm2 G A 13: 97,311,532 (GRCm39) V701I probably benign Het
Gm3250 T C 10: 77,618,061 (GRCm39) T106A unknown Het
Gm7356 T C 17: 14,221,843 (GRCm39) N62S probably benign Het
Gsdmc4 T C 15: 63,774,689 (GRCm39) T31A possibly damaging Het
H2-M10.1 T A 17: 36,636,621 (GRCm39) D61V probably damaging Het
Heatr5a A G 12: 51,972,122 (GRCm39) L716S probably damaging Het
Hecw2 A G 1: 53,953,753 (GRCm39) Y831H probably damaging Het
Ifi202b C T 1: 173,802,381 (GRCm39) S151N probably benign Het
Il15ra C T 2: 11,723,192 (GRCm39) T72I probably damaging Het
Ints1 A G 5: 139,750,829 (GRCm39) L858P probably damaging Het
Kat2a C T 11: 100,601,726 (GRCm39) V230I possibly damaging Het
Kcnq2 A T 2: 180,730,172 (GRCm39) I498N possibly damaging Het
Kif26b C T 1: 178,506,611 (GRCm39) T229I possibly damaging Het
Ly75 T A 2: 60,160,337 (GRCm39) I957F probably damaging Het
Map3k12 T A 15: 102,410,601 (GRCm39) R459W probably damaging Het
Mia2 T A 12: 59,205,155 (GRCm39) probably null Het
Mrgprf A G 7: 144,861,206 (GRCm39) I53V unknown Het
Mttp A G 3: 137,796,964 (GRCm39) L846P probably damaging Het
Myrip C T 9: 120,246,207 (GRCm39) L112F probably damaging Het
Nav1 A G 1: 135,393,597 (GRCm39) F1047S probably damaging Het
Nfkbib T C 7: 28,458,628 (GRCm39) D327G possibly damaging Het
Notch1 C T 2: 26,366,387 (GRCm39) V776I probably benign Het
Obsl1 G T 1: 75,466,161 (GRCm39) D1522E probably damaging Het
Or52s6 T A 7: 103,091,995 (GRCm39) M112L probably benign Het
Or5b110-ps1 A T 19: 13,259,517 (GRCm39) F302I unknown Het
Or7e168 T C 9: 19,719,944 (GRCm39) M110T possibly damaging Het
Or9r3 T C 10: 129,948,093 (GRCm39) K189E probably benign Het
Pde7a T C 3: 19,281,838 (GRCm39) N471D probably benign Het
Pla2r1 T C 2: 60,360,779 (GRCm39) H203R probably benign Het
Plch2 C A 4: 155,082,929 (GRCm39) C573F probably damaging Het
Polr1a G A 6: 71,918,440 (GRCm39) R666Q probably benign Het
Prepl T C 17: 85,388,668 (GRCm39) N145S probably benign Het
Psen2 C T 1: 180,066,521 (GRCm39) V139M probably benign Het
Ptgdr A T 14: 45,096,649 (GRCm39) M21K possibly damaging Het
Rapgef6 T C 11: 54,582,065 (GRCm39) W1331R probably benign Het
Rp1l1 G A 14: 64,269,747 (GRCm39) G1778S probably benign Het
Rrbp1 A T 2: 143,811,382 (GRCm39) M824K probably benign Het
Sel1l T C 12: 91,815,739 (GRCm39) T23A probably benign Het
Sele A G 1: 163,881,437 (GRCm39) S515G possibly damaging Het
Slc22a23 T C 13: 34,381,822 (GRCm39) N421D probably damaging Het
Slc35f3 T G 8: 127,121,297 (GRCm39) L386R probably benign Het
Stab2 G A 10: 86,782,084 (GRCm39) S699L probably damaging Het
Synrg A T 11: 83,900,207 (GRCm39) L726F probably damaging Het
Syt3 G A 7: 44,045,343 (GRCm39) V528M probably damaging Het
Szt2 A G 4: 118,248,446 (GRCm39) I655T probably damaging Het
Tbr1 T C 2: 61,642,600 (GRCm39) S622P probably damaging Het
Tex36 C T 7: 133,188,952 (GRCm39) G207S probably benign Het
Trav5n-4 G A 14: 53,550,399 (GRCm39) W13* probably null Het
Ugt2b38 A T 5: 87,559,754 (GRCm39) N379K probably damaging Het
Unc13d T C 11: 115,964,876 (GRCm39) R248G possibly damaging Het
Vmn1r195 C T 13: 22,462,919 (GRCm39) L130F probably damaging Het
Vmn2r110 T C 17: 20,794,471 (GRCm39) I733V probably benign Het
Zfp870 T A 17: 33,102,828 (GRCm39) N167I probably damaging Het
Zmynd10 A T 9: 107,426,503 (GRCm39) M179L probably benign Het
Other mutations in Trdn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:Trdn APN 10 33,347,602 (GRCm39) critical splice donor site probably null
IGL01310:Trdn APN 10 33,181,094 (GRCm39) splice site probably benign
IGL01313:Trdn APN 10 33,076,216 (GRCm39) missense probably damaging 1.00
IGL02177:Trdn APN 10 33,015,169 (GRCm39) missense probably damaging 1.00
IGL02631:Trdn APN 10 33,239,972 (GRCm39) critical splice acceptor site probably null
IGL02732:Trdn APN 10 33,344,195 (GRCm39) splice site probably null
IGL03131:Trdn APN 10 33,274,410 (GRCm39) nonsense probably null
Button UTSW 10 33,350,449 (GRCm39) missense probably damaging 0.97
R0463:Trdn UTSW 10 33,342,417 (GRCm39) critical splice acceptor site probably null
R0610:Trdn UTSW 10 33,350,449 (GRCm39) missense probably damaging 0.97
R0786:Trdn UTSW 10 33,181,077 (GRCm39) missense probably benign 0.22
R0827:Trdn UTSW 10 33,275,154 (GRCm39) splice site probably benign
R1511:Trdn UTSW 10 33,342,448 (GRCm39) missense probably benign 0.18
R1623:Trdn UTSW 10 33,134,098 (GRCm39) missense possibly damaging 0.82
R1760:Trdn UTSW 10 33,109,883 (GRCm39) missense possibly damaging 0.92
R1766:Trdn UTSW 10 33,240,004 (GRCm39) missense probably damaging 1.00
R1884:Trdn UTSW 10 33,133,091 (GRCm39) missense probably benign 0.38
R2297:Trdn UTSW 10 33,211,008 (GRCm39) missense probably damaging 1.00
R2396:Trdn UTSW 10 33,071,978 (GRCm39) missense probably damaging 1.00
R3436:Trdn UTSW 10 33,344,191 (GRCm39) critical splice donor site probably null
R3686:Trdn UTSW 10 33,344,185 (GRCm39) missense probably benign 0.20
R3696:Trdn UTSW 10 33,181,028 (GRCm39) splice site probably null
R3701:Trdn UTSW 10 33,210,980 (GRCm39) missense probably damaging 0.99
R3712:Trdn UTSW 10 33,033,162 (GRCm39) missense probably benign 0.03
R4062:Trdn UTSW 10 33,133,083 (GRCm39) missense probably benign 0.05
R4249:Trdn UTSW 10 33,326,994 (GRCm39) missense probably benign 0.09
R4289:Trdn UTSW 10 33,340,578 (GRCm39) missense probably benign 0.00
R4646:Trdn UTSW 10 33,071,977 (GRCm39) nonsense probably null
R4647:Trdn UTSW 10 33,071,977 (GRCm39) nonsense probably null
R4648:Trdn UTSW 10 33,071,977 (GRCm39) nonsense probably null
R4766:Trdn UTSW 10 33,350,502 (GRCm39) missense probably benign 0.04
R4776:Trdn UTSW 10 33,275,078 (GRCm39) splice site probably null
R4880:Trdn UTSW 10 33,347,575 (GRCm39) missense probably benign 0.26
R4898:Trdn UTSW 10 33,350,413 (GRCm39) missense probably damaging 0.96
R5017:Trdn UTSW 10 33,344,155 (GRCm39) missense probably benign 0.05
R5300:Trdn UTSW 10 33,071,978 (GRCm39) missense probably damaging 1.00
R5320:Trdn UTSW 10 33,209,247 (GRCm39) critical splice donor site probably null
R6089:Trdn UTSW 10 33,340,571 (GRCm39) missense probably benign 0.01
R6216:Trdn UTSW 10 33,181,065 (GRCm39) missense probably damaging 1.00
R6431:Trdn UTSW 10 33,015,110 (GRCm39) missense probably damaging 1.00
R6475:Trdn UTSW 10 33,340,551 (GRCm39) splice site probably null
R6501:Trdn UTSW 10 33,342,450 (GRCm39) missense probably benign 0.02
R6662:Trdn UTSW 10 33,350,483 (GRCm39) missense probably damaging 0.98
R6709:Trdn UTSW 10 33,340,587 (GRCm39) missense probably benign 0.00
R6783:Trdn UTSW 10 33,314,811 (GRCm39) missense probably damaging 0.96
R6906:Trdn UTSW 10 33,109,944 (GRCm39) missense probably benign
R6916:Trdn UTSW 10 33,033,014 (GRCm39) missense probably damaging 1.00
R7499:Trdn UTSW 10 33,072,097 (GRCm39) missense probably benign
R7601:Trdn UTSW 10 33,072,152 (GRCm39) missense probably benign 0.00
R7743:Trdn UTSW 10 33,133,058 (GRCm39) nonsense probably null
R8114:Trdn UTSW 10 32,959,624 (GRCm39) start gained probably benign
R8220:Trdn UTSW 10 33,326,981 (GRCm39) missense possibly damaging 0.57
R8228:Trdn UTSW 10 33,033,014 (GRCm39) missense probably damaging 1.00
R8329:Trdn UTSW 10 33,320,074 (GRCm39) splice site probably null
R8918:Trdn UTSW 10 33,015,117 (GRCm39) missense probably benign 0.33
R9304:Trdn UTSW 10 33,181,087 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCAAGTATCTGTTCACCTGAGG -3'
(R):5'- CCATCTGCATAACTACTGTATTGAG -3'

Sequencing Primer
(F):5'- GTTCACCTGAGGCACATTTTAAAAAC -3'
(R):5'- CTACTGTATTGAGGATAGCACTTGCC -3'
Posted On 2019-06-26