Incidental Mutation 'R7291:Or9r3'
ID 566426
Institutional Source Beutler Lab
Gene Symbol Or9r3
Ensembl Gene ENSMUSG00000096747
Gene Name olfactory receptor family 9 subfamily R member 3
Synonyms Olfr823, MOR210-4, GA_x6K02T2PULF-11783479-11782532
MMRRC Submission 045322-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.088) question?
Stock # R7291 (G1)
Quality Score 152.008
Status Not validated
Chromosome 10
Chromosomal Location 129947710-129948657 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 129948093 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 189 (K189E)
Ref Sequence ENSEMBL: ENSMUSP00000150794 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081469] [ENSMUST00000213145]
AlphaFold Q7TRH2
Predicted Effect probably benign
Transcript: ENSMUST00000081469
AA Change: K189E

PolyPhen 2 Score 0.069 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000080189
Gene: ENSMUSG00000096747
AA Change: K189E

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 1.6e-54 PFAM
Pfam:7tm_1 44 293 7.6e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213145
AA Change: K189E

PolyPhen 2 Score 0.069 (Sensitivity: 0.94; Specificity: 0.84)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430069I07Rik T C 15: 34,355,699 (GRCm39) E51G possibly damaging Het
Abca14 C A 7: 119,888,832 (GRCm39) C1259* probably null Het
Ablim1 T C 19: 57,204,340 (GRCm39) E17G probably benign Het
Acsf3 G A 8: 123,540,316 (GRCm39) V505I probably benign Het
Actn1 T C 12: 80,220,859 (GRCm39) M650V probably benign Het
Adamts4 G A 1: 171,084,097 (GRCm39) V525I probably benign Het
Adh1 T C 3: 137,988,569 (GRCm39) Y181H probably damaging Het
Alpl G A 4: 137,480,009 (GRCm39) R168W probably damaging Het
Ate1 T G 7: 130,121,661 (GRCm39) K11Q probably benign Het
Atpaf1 T A 4: 115,668,288 (GRCm39) F314L probably damaging Het
Baiap3 T A 17: 25,463,291 (GRCm39) D1004V probably damaging Het
Bpifb9a C T 2: 154,109,616 (GRCm39) T504M probably damaging Het
C1s2 T A 6: 124,602,343 (GRCm39) I623F probably benign Het
Card11 T C 5: 140,886,825 (GRCm39) D308G probably damaging Het
Cul9 C T 17: 46,851,359 (GRCm39) V354I probably benign Het
Dnah1 A T 14: 31,020,662 (GRCm39) F1236I probably damaging Het
Dync2h1 T A 9: 6,929,590 (GRCm39) I4266F possibly damaging Het
Ear10 A T 14: 44,160,377 (GRCm39) V150D probably damaging Het
Elfn2 C T 15: 78,557,183 (GRCm39) A455T probably benign Het
Erp44 A G 4: 48,208,792 (GRCm39) Y223H probably damaging Het
Fam110b T A 4: 5,798,895 (GRCm39) H104Q probably benign Het
Fcgbp A G 7: 27,800,817 (GRCm39) N1288D probably benign Het
Fcgbpl1 A C 7: 27,839,645 (GRCm39) D486A probably benign Het
Fcrl1 T C 3: 87,293,088 (GRCm39) probably null Het
Fmo2 G T 1: 162,715,271 (GRCm39) P117Q probably benign Het
Fsip2 A G 2: 82,810,863 (GRCm39) K2394R possibly damaging Het
Gab1 T G 8: 81,526,780 (GRCm39) K106T probably damaging Het
Gatad2b T C 3: 90,258,721 (GRCm39) V248A probably damaging Het
Gemin6 T C 17: 80,535,204 (GRCm39) S55P possibly damaging Het
Gfm2 G A 13: 97,311,532 (GRCm39) V701I probably benign Het
Gm3250 T C 10: 77,618,061 (GRCm39) T106A unknown Het
Gm7356 T C 17: 14,221,843 (GRCm39) N62S probably benign Het
Gsdmc4 T C 15: 63,774,689 (GRCm39) T31A possibly damaging Het
H2-M10.1 T A 17: 36,636,621 (GRCm39) D61V probably damaging Het
Heatr5a A G 12: 51,972,122 (GRCm39) L716S probably damaging Het
Hecw2 A G 1: 53,953,753 (GRCm39) Y831H probably damaging Het
Ifi202b C T 1: 173,802,381 (GRCm39) S151N probably benign Het
Il15ra C T 2: 11,723,192 (GRCm39) T72I probably damaging Het
Ints1 A G 5: 139,750,829 (GRCm39) L858P probably damaging Het
Kat2a C T 11: 100,601,726 (GRCm39) V230I possibly damaging Het
Kcnq2 A T 2: 180,730,172 (GRCm39) I498N possibly damaging Het
Kif26b C T 1: 178,506,611 (GRCm39) T229I possibly damaging Het
Ly75 T A 2: 60,160,337 (GRCm39) I957F probably damaging Het
Map3k12 T A 15: 102,410,601 (GRCm39) R459W probably damaging Het
Mia2 T A 12: 59,205,155 (GRCm39) probably null Het
Mrgprf A G 7: 144,861,206 (GRCm39) I53V unknown Het
Mttp A G 3: 137,796,964 (GRCm39) L846P probably damaging Het
Myrip C T 9: 120,246,207 (GRCm39) L112F probably damaging Het
Nav1 A G 1: 135,393,597 (GRCm39) F1047S probably damaging Het
Nfkbib T C 7: 28,458,628 (GRCm39) D327G possibly damaging Het
Notch1 C T 2: 26,366,387 (GRCm39) V776I probably benign Het
Obsl1 G T 1: 75,466,161 (GRCm39) D1522E probably damaging Het
Or52s6 T A 7: 103,091,995 (GRCm39) M112L probably benign Het
Or5b110-ps1 A T 19: 13,259,517 (GRCm39) F302I unknown Het
Or7e168 T C 9: 19,719,944 (GRCm39) M110T possibly damaging Het
Pde7a T C 3: 19,281,838 (GRCm39) N471D probably benign Het
Pla2r1 T C 2: 60,360,779 (GRCm39) H203R probably benign Het
Plch2 C A 4: 155,082,929 (GRCm39) C573F probably damaging Het
Polr1a G A 6: 71,918,440 (GRCm39) R666Q probably benign Het
Prepl T C 17: 85,388,668 (GRCm39) N145S probably benign Het
Psen2 C T 1: 180,066,521 (GRCm39) V139M probably benign Het
Ptgdr A T 14: 45,096,649 (GRCm39) M21K possibly damaging Het
Rapgef6 T C 11: 54,582,065 (GRCm39) W1331R probably benign Het
Rp1l1 G A 14: 64,269,747 (GRCm39) G1778S probably benign Het
Rrbp1 A T 2: 143,811,382 (GRCm39) M824K probably benign Het
Sel1l T C 12: 91,815,739 (GRCm39) T23A probably benign Het
Sele A G 1: 163,881,437 (GRCm39) S515G possibly damaging Het
Slc22a23 T C 13: 34,381,822 (GRCm39) N421D probably damaging Het
Slc35f3 T G 8: 127,121,297 (GRCm39) L386R probably benign Het
Stab2 G A 10: 86,782,084 (GRCm39) S699L probably damaging Het
Synrg A T 11: 83,900,207 (GRCm39) L726F probably damaging Het
Syt3 G A 7: 44,045,343 (GRCm39) V528M probably damaging Het
Szt2 A G 4: 118,248,446 (GRCm39) I655T probably damaging Het
Tbr1 T C 2: 61,642,600 (GRCm39) S622P probably damaging Het
Tex36 C T 7: 133,188,952 (GRCm39) G207S probably benign Het
Trav5n-4 G A 14: 53,550,399 (GRCm39) W13* probably null Het
Trdn A T 10: 33,313,732 (GRCm39) E500V probably null Het
Ugt2b38 A T 5: 87,559,754 (GRCm39) N379K probably damaging Het
Unc13d T C 11: 115,964,876 (GRCm39) R248G possibly damaging Het
Vmn1r195 C T 13: 22,462,919 (GRCm39) L130F probably damaging Het
Vmn2r110 T C 17: 20,794,471 (GRCm39) I733V probably benign Het
Zfp870 T A 17: 33,102,828 (GRCm39) N167I probably damaging Het
Zmynd10 A T 9: 107,426,503 (GRCm39) M179L probably benign Het
Other mutations in Or9r3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02728:Or9r3 APN 10 129,948,487 (GRCm39) missense probably damaging 1.00
R0472:Or9r3 UTSW 10 129,948,449 (GRCm39) missense probably damaging 1.00
R0609:Or9r3 UTSW 10 129,948,449 (GRCm39) missense probably damaging 1.00
R1619:Or9r3 UTSW 10 129,948,548 (GRCm39) missense possibly damaging 0.89
R1641:Or9r3 UTSW 10 129,947,872 (GRCm39) nonsense probably null
R2057:Or9r3 UTSW 10 129,947,859 (GRCm39) missense probably benign 0.00
R6049:Or9r3 UTSW 10 129,948,481 (GRCm39) missense probably benign 0.01
R6638:Or9r3 UTSW 10 129,947,739 (GRCm39) missense probably benign 0.04
R7602:Or9r3 UTSW 10 129,948,179 (GRCm39) missense probably benign 0.00
R8167:Or9r3 UTSW 10 129,948,350 (GRCm39) missense probably damaging 1.00
R8815:Or9r3 UTSW 10 129,947,808 (GRCm39) missense probably damaging 0.98
R9169:Or9r3 UTSW 10 129,947,723 (GRCm39) missense probably benign 0.04
R9647:Or9r3 UTSW 10 129,948,029 (GRCm39) missense probably damaging 0.99
X0022:Or9r3 UTSW 10 129,948,576 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- ACTCACCACTGCTATATGAGAGC -3'
(R):5'- CTGTGATGGCTTATGACCGC -3'

Sequencing Primer
(F):5'- GCCACATGTAGAGAAGGTTTTACTCC -3'
(R):5'- GATGGCTTATGACCGCTTCTCAG -3'
Posted On 2019-06-26