Incidental Mutation 'R7291:Unc13d'
ID 566430
Institutional Source Beutler Lab
Gene Symbol Unc13d
Ensembl Gene ENSMUSG00000057948
Gene Name unc-13 homolog D
Synonyms Jinx, 2610108D09Rik, Munc13-4
MMRRC Submission 045322-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.120) question?
Stock # R7291 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 115952921-115968787 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 115964876 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 248 (R248G)
Ref Sequence ENSEMBL: ENSMUSP00000134260 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074628] [ENSMUST00000075036] [ENSMUST00000106450] [ENSMUST00000106451] [ENSMUST00000153408] [ENSMUST00000156545] [ENSMUST00000174822] [ENSMUST00000173345]
AlphaFold B2RUP2
Predicted Effect probably benign
Transcript: ENSMUST00000074628
SMART Domains Protein: ENSMUSP00000074204
Gene: ENSMUSG00000034341

DomainStartEndE-ValueType
Pfam:GRAM 1 84 1.2e-19 PFAM
Pfam:WWbp 100 204 1.3e-20 PFAM
low complexity region 247 255 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000075036
AA Change: R248G

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000074549
Gene: ENSMUSG00000057948
AA Change: R248G

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
C2 111 261 5.31e-11 SMART
PDB:3SWH|B 585 735 8e-6 PDB
low complexity region 738 751 N/A INTRINSIC
Pfam:Membr_traf_MHD 785 892 1.9e-25 PFAM
C2 923 1031 7.93e-10 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000106450
AA Change: R248G

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102058
Gene: ENSMUSG00000057948
AA Change: R248G

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
C2 111 261 5.31e-11 SMART
PDB:3SWH|B 587 737 8e-6 PDB
low complexity region 740 753 N/A INTRINSIC
Pfam:Membr_traf_MHD 787 894 1.9e-25 PFAM
C2 925 1033 7.93e-10 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000106451
AA Change: R248G

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102059
Gene: ENSMUSG00000057948
AA Change: R248G

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
C2 111 261 5.31e-11 SMART
PDB:3SWH|B 587 737 8e-6 PDB
low complexity region 740 753 N/A INTRINSIC
Pfam:Membr_traf_MHD 788 838 7.1e-10 PFAM
Pfam:Membr_traf_MHD 830 893 1.4e-15 PFAM
C2 925 1033 7.93e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153408
SMART Domains Protein: ENSMUSP00000115327
Gene: ENSMUSG00000057948

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156545
SMART Domains Protein: ENSMUSP00000118266
Gene: ENSMUSG00000057948

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000174822
AA Change: R248G

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000134260
Gene: ENSMUSG00000057948
AA Change: R248G

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
C2 111 261 5.31e-11 SMART
PDB:3SWH|B 585 735 8e-6 PDB
low complexity region 738 751 N/A INTRINSIC
Pfam:Membr_traf_MHD 785 892 1.9e-25 PFAM
C2 923 1031 7.93e-10 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000173345
AA Change: R248G

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000133679
Gene: ENSMUSG00000057948
AA Change: R248G

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
C2 111 261 5.31e-11 SMART
PDB:3SWH|B 587 737 5e-6 PDB
low complexity region 740 753 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a member of the UNC13 family, containing similar domain structure as other family members but lacking an N-terminal phorbol ester-binding C1 domain present in other Munc13 proteins. The protein appears to play a role in vesicle maturation during exocytosis and is involved in regulation of cytolytic granules secretion. Mutations in this gene are associated with familial hemophagocytic lymphohistiocytosis type 3, a genetically heterogeneous, rare autosomal recessive disorder. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted deletion of this gene leads to defective hemostasis, abrogated thrombus formation and protection of homozygotes from ischemic stroke in the absence of intracranial bleeding. Homozygous ENU mutant mice are sensitive to infection by mouse cytomegalovirus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430069I07Rik T C 15: 34,355,699 (GRCm39) E51G possibly damaging Het
Abca14 C A 7: 119,888,832 (GRCm39) C1259* probably null Het
Ablim1 T C 19: 57,204,340 (GRCm39) E17G probably benign Het
Acsf3 G A 8: 123,540,316 (GRCm39) V505I probably benign Het
Actn1 T C 12: 80,220,859 (GRCm39) M650V probably benign Het
Adamts4 G A 1: 171,084,097 (GRCm39) V525I probably benign Het
Adh1 T C 3: 137,988,569 (GRCm39) Y181H probably damaging Het
Alpl G A 4: 137,480,009 (GRCm39) R168W probably damaging Het
Ate1 T G 7: 130,121,661 (GRCm39) K11Q probably benign Het
Atpaf1 T A 4: 115,668,288 (GRCm39) F314L probably damaging Het
Baiap3 T A 17: 25,463,291 (GRCm39) D1004V probably damaging Het
Bpifb9a C T 2: 154,109,616 (GRCm39) T504M probably damaging Het
C1s2 T A 6: 124,602,343 (GRCm39) I623F probably benign Het
Card11 T C 5: 140,886,825 (GRCm39) D308G probably damaging Het
Cul9 C T 17: 46,851,359 (GRCm39) V354I probably benign Het
Dnah1 A T 14: 31,020,662 (GRCm39) F1236I probably damaging Het
Dync2h1 T A 9: 6,929,590 (GRCm39) I4266F possibly damaging Het
Ear10 A T 14: 44,160,377 (GRCm39) V150D probably damaging Het
Elfn2 C T 15: 78,557,183 (GRCm39) A455T probably benign Het
Erp44 A G 4: 48,208,792 (GRCm39) Y223H probably damaging Het
Fam110b T A 4: 5,798,895 (GRCm39) H104Q probably benign Het
Fcgbp A G 7: 27,800,817 (GRCm39) N1288D probably benign Het
Fcgbpl1 A C 7: 27,839,645 (GRCm39) D486A probably benign Het
Fcrl1 T C 3: 87,293,088 (GRCm39) probably null Het
Fmo2 G T 1: 162,715,271 (GRCm39) P117Q probably benign Het
Fsip2 A G 2: 82,810,863 (GRCm39) K2394R possibly damaging Het
Gab1 T G 8: 81,526,780 (GRCm39) K106T probably damaging Het
Gatad2b T C 3: 90,258,721 (GRCm39) V248A probably damaging Het
Gemin6 T C 17: 80,535,204 (GRCm39) S55P possibly damaging Het
Gfm2 G A 13: 97,311,532 (GRCm39) V701I probably benign Het
Gm3250 T C 10: 77,618,061 (GRCm39) T106A unknown Het
Gm7356 T C 17: 14,221,843 (GRCm39) N62S probably benign Het
Gsdmc4 T C 15: 63,774,689 (GRCm39) T31A possibly damaging Het
H2-M10.1 T A 17: 36,636,621 (GRCm39) D61V probably damaging Het
Heatr5a A G 12: 51,972,122 (GRCm39) L716S probably damaging Het
Hecw2 A G 1: 53,953,753 (GRCm39) Y831H probably damaging Het
Ifi202b C T 1: 173,802,381 (GRCm39) S151N probably benign Het
Il15ra C T 2: 11,723,192 (GRCm39) T72I probably damaging Het
Ints1 A G 5: 139,750,829 (GRCm39) L858P probably damaging Het
Kat2a C T 11: 100,601,726 (GRCm39) V230I possibly damaging Het
Kcnq2 A T 2: 180,730,172 (GRCm39) I498N possibly damaging Het
Kif26b C T 1: 178,506,611 (GRCm39) T229I possibly damaging Het
Ly75 T A 2: 60,160,337 (GRCm39) I957F probably damaging Het
Map3k12 T A 15: 102,410,601 (GRCm39) R459W probably damaging Het
Mia2 T A 12: 59,205,155 (GRCm39) probably null Het
Mrgprf A G 7: 144,861,206 (GRCm39) I53V unknown Het
Mttp A G 3: 137,796,964 (GRCm39) L846P probably damaging Het
Myrip C T 9: 120,246,207 (GRCm39) L112F probably damaging Het
Nav1 A G 1: 135,393,597 (GRCm39) F1047S probably damaging Het
Nfkbib T C 7: 28,458,628 (GRCm39) D327G possibly damaging Het
Notch1 C T 2: 26,366,387 (GRCm39) V776I probably benign Het
Obsl1 G T 1: 75,466,161 (GRCm39) D1522E probably damaging Het
Or52s6 T A 7: 103,091,995 (GRCm39) M112L probably benign Het
Or5b110-ps1 A T 19: 13,259,517 (GRCm39) F302I unknown Het
Or7e168 T C 9: 19,719,944 (GRCm39) M110T possibly damaging Het
Or9r3 T C 10: 129,948,093 (GRCm39) K189E probably benign Het
Pde7a T C 3: 19,281,838 (GRCm39) N471D probably benign Het
Pla2r1 T C 2: 60,360,779 (GRCm39) H203R probably benign Het
Plch2 C A 4: 155,082,929 (GRCm39) C573F probably damaging Het
Polr1a G A 6: 71,918,440 (GRCm39) R666Q probably benign Het
Prepl T C 17: 85,388,668 (GRCm39) N145S probably benign Het
Psen2 C T 1: 180,066,521 (GRCm39) V139M probably benign Het
Ptgdr A T 14: 45,096,649 (GRCm39) M21K possibly damaging Het
Rapgef6 T C 11: 54,582,065 (GRCm39) W1331R probably benign Het
Rp1l1 G A 14: 64,269,747 (GRCm39) G1778S probably benign Het
Rrbp1 A T 2: 143,811,382 (GRCm39) M824K probably benign Het
Sel1l T C 12: 91,815,739 (GRCm39) T23A probably benign Het
Sele A G 1: 163,881,437 (GRCm39) S515G possibly damaging Het
Slc22a23 T C 13: 34,381,822 (GRCm39) N421D probably damaging Het
Slc35f3 T G 8: 127,121,297 (GRCm39) L386R probably benign Het
Stab2 G A 10: 86,782,084 (GRCm39) S699L probably damaging Het
Synrg A T 11: 83,900,207 (GRCm39) L726F probably damaging Het
Syt3 G A 7: 44,045,343 (GRCm39) V528M probably damaging Het
Szt2 A G 4: 118,248,446 (GRCm39) I655T probably damaging Het
Tbr1 T C 2: 61,642,600 (GRCm39) S622P probably damaging Het
Tex36 C T 7: 133,188,952 (GRCm39) G207S probably benign Het
Trav5n-4 G A 14: 53,550,399 (GRCm39) W13* probably null Het
Trdn A T 10: 33,313,732 (GRCm39) E500V probably null Het
Ugt2b38 A T 5: 87,559,754 (GRCm39) N379K probably damaging Het
Vmn1r195 C T 13: 22,462,919 (GRCm39) L130F probably damaging Het
Vmn2r110 T C 17: 20,794,471 (GRCm39) I733V probably benign Het
Zfp870 T A 17: 33,102,828 (GRCm39) N167I probably damaging Het
Zmynd10 A T 9: 107,426,503 (GRCm39) M179L probably benign Het
Other mutations in Unc13d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00711:Unc13d APN 11 115,965,229 (GRCm39) missense probably damaging 0.99
IGL00976:Unc13d APN 11 115,961,293 (GRCm39) missense probably damaging 1.00
IGL01630:Unc13d APN 11 115,964,692 (GRCm39) missense probably benign 0.00
IGL01761:Unc13d APN 11 115,964,695 (GRCm39) missense probably damaging 1.00
IGL01772:Unc13d APN 11 115,967,358 (GRCm39) missense possibly damaging 0.91
IGL01935:Unc13d APN 11 115,960,577 (GRCm39) missense probably benign
IGL02486:Unc13d APN 11 115,960,632 (GRCm39) splice site probably benign
IGL02503:Unc13d APN 11 115,959,628 (GRCm39) missense possibly damaging 0.82
IGL02519:Unc13d APN 11 115,961,359 (GRCm39) missense probably damaging 1.00
IGL02524:Unc13d APN 11 115,961,145 (GRCm39) missense probably damaging 1.00
IGL02634:Unc13d APN 11 115,961,382 (GRCm39) splice site probably benign
IGL02636:Unc13d APN 11 115,964,444 (GRCm39) missense probably damaging 1.00
IGL03243:Unc13d APN 11 115,958,670 (GRCm39) missense probably benign 0.34
jinx UTSW 11 115,964,249 (GRCm39) unclassified probably benign
R0033:Unc13d UTSW 11 115,959,991 (GRCm39) missense probably benign 0.00
R0084:Unc13d UTSW 11 115,954,657 (GRCm39) missense probably damaging 1.00
R0122:Unc13d UTSW 11 115,956,308 (GRCm39) missense probably benign 0.00
R0422:Unc13d UTSW 11 115,960,846 (GRCm39) critical splice donor site probably null
R0666:Unc13d UTSW 11 115,960,318 (GRCm39) splice site probably benign
R1019:Unc13d UTSW 11 115,958,900 (GRCm39) missense probably benign 0.03
R1333:Unc13d UTSW 11 115,964,381 (GRCm39) splice site probably benign
R1484:Unc13d UTSW 11 115,964,701 (GRCm39) missense possibly damaging 0.72
R1594:Unc13d UTSW 11 115,959,538 (GRCm39) missense probably benign 0.04
R1597:Unc13d UTSW 11 115,965,262 (GRCm39) missense probably benign 0.02
R1603:Unc13d UTSW 11 115,964,481 (GRCm39) missense possibly damaging 0.86
R1662:Unc13d UTSW 11 115,959,499 (GRCm39) missense probably null 1.00
R1909:Unc13d UTSW 11 115,961,121 (GRCm39) missense probably damaging 0.99
R2015:Unc13d UTSW 11 115,959,581 (GRCm39) missense probably damaging 1.00
R2313:Unc13d UTSW 11 115,954,560 (GRCm39) missense probably damaging 1.00
R2435:Unc13d UTSW 11 115,959,514 (GRCm39) missense probably damaging 1.00
R4705:Unc13d UTSW 11 115,964,214 (GRCm39) missense possibly damaging 0.70
R4732:Unc13d UTSW 11 115,964,408 (GRCm39) missense possibly damaging 0.91
R4733:Unc13d UTSW 11 115,964,408 (GRCm39) missense possibly damaging 0.91
R4792:Unc13d UTSW 11 115,961,108 (GRCm39) missense probably damaging 1.00
R4843:Unc13d UTSW 11 115,965,085 (GRCm39) missense probably damaging 1.00
R5496:Unc13d UTSW 11 115,957,534 (GRCm39) missense probably damaging 1.00
R5571:Unc13d UTSW 11 115,954,480 (GRCm39) missense probably benign 0.00
R5589:Unc13d UTSW 11 115,960,579 (GRCm39) missense probably damaging 0.99
R5838:Unc13d UTSW 11 115,955,451 (GRCm39) missense possibly damaging 0.80
R6058:Unc13d UTSW 11 115,964,394 (GRCm39) critical splice donor site probably null
R6266:Unc13d UTSW 11 115,959,064 (GRCm39) missense probably damaging 1.00
R6807:Unc13d UTSW 11 115,957,577 (GRCm39) missense probably damaging 0.98
R7085:Unc13d UTSW 11 115,955,633 (GRCm39) missense probably benign 0.07
R7098:Unc13d UTSW 11 115,954,552 (GRCm39) missense probably damaging 1.00
R7269:Unc13d UTSW 11 115,959,056 (GRCm39) missense probably benign 0.01
R7453:Unc13d UTSW 11 115,958,697 (GRCm39) missense probably benign
R7486:Unc13d UTSW 11 115,965,259 (GRCm39) missense possibly damaging 0.68
R7618:Unc13d UTSW 11 115,957,547 (GRCm39) missense probably damaging 1.00
R7817:Unc13d UTSW 11 115,967,109 (GRCm39) missense probably damaging 1.00
R8290:Unc13d UTSW 11 115,958,973 (GRCm39) missense probably damaging 0.97
R8442:Unc13d UTSW 11 115,958,657 (GRCm39) missense probably damaging 0.99
R8817:Unc13d UTSW 11 115,958,998 (GRCm39) small insertion probably benign
R8818:Unc13d UTSW 11 115,958,998 (GRCm39) small insertion probably benign
R8820:Unc13d UTSW 11 115,958,998 (GRCm39) small insertion probably benign
R8821:Unc13d UTSW 11 115,958,998 (GRCm39) small insertion probably benign
R8858:Unc13d UTSW 11 115,953,618 (GRCm39) missense probably damaging 1.00
R9031:Unc13d UTSW 11 115,958,998 (GRCm39) small insertion probably benign
R9066:Unc13d UTSW 11 115,957,561 (GRCm39) missense probably benign 0.07
R9084:Unc13d UTSW 11 115,958,998 (GRCm39) small insertion probably benign
R9085:Unc13d UTSW 11 115,958,998 (GRCm39) small insertion probably benign
R9258:Unc13d UTSW 11 115,959,007 (GRCm39) small insertion probably benign
R9258:Unc13d UTSW 11 115,958,998 (GRCm39) small insertion probably benign
R9259:Unc13d UTSW 11 115,958,998 (GRCm39) small insertion probably benign
R9260:Unc13d UTSW 11 115,958,998 (GRCm39) small insertion probably benign
R9396:Unc13d UTSW 11 115,966,529 (GRCm39) critical splice donor site probably null
R9612:Unc13d UTSW 11 115,961,144 (GRCm39) nonsense probably null
R9648:Unc13d UTSW 11 115,958,998 (GRCm39) small insertion probably benign
R9649:Unc13d UTSW 11 115,958,998 (GRCm39) small insertion probably benign
R9650:Unc13d UTSW 11 115,958,998 (GRCm39) small insertion probably benign
X0027:Unc13d UTSW 11 115,960,582 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGGTCCTAAGCAAGCAAG -3'
(R):5'- TGGACACTGTGGAGTCTGTCAG -3'

Sequencing Primer
(F):5'- CAAGACATGCAATGCTGAGC -3'
(R):5'- TGTCAGGCAGAAGCTCGG -3'
Posted On 2019-06-26