Incidental Mutation 'R7291:Mia2'
ID566432
Institutional Source Beutler Lab
Gene Symbol Mia2
Ensembl Gene ENSMUSG00000021000
Gene Namemelanoma inhibitory activity 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.944) question?
Stock #R7291 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location59095799-59191583 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 59158369 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135245 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069430] [ENSMUST00000170992] [ENSMUST00000175877] [ENSMUST00000175912] [ENSMUST00000176322] [ENSMUST00000176336] [ENSMUST00000176464] [ENSMUST00000176727] [ENSMUST00000176752] [ENSMUST00000176892] [ENSMUST00000177162] [ENSMUST00000177225] [ENSMUST00000219140]
Predicted Effect probably null
Transcript: ENSMUST00000069430
SMART Domains Protein: ENSMUSP00000070572
Gene: ENSMUSG00000021000

DomainStartEndE-ValueType
transmembrane domain 26 48 N/A INTRINSIC
SCOP:d1fxkc_ 124 253 9e-6 SMART
SCOP:d1fxkc_ 314 437 3e-16 SMART
low complexity region 480 493 N/A INTRINSIC
low complexity region 533 556 N/A INTRINSIC
low complexity region 682 700 N/A INTRINSIC
low complexity region 707 717 N/A INTRINSIC
low complexity region 722 742 N/A INTRINSIC
low complexity region 751 775 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000170992
SMART Domains Protein: ENSMUSP00000126538
Gene: ENSMUSG00000021000

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
transmembrane domain 37 59 N/A INTRINSIC
SCOP:d1fxkc_ 102 231 2e-6 SMART
SCOP:d1fxkc_ 292 415 2e-17 SMART
low complexity region 458 471 N/A INTRINSIC
low complexity region 511 534 N/A INTRINSIC
low complexity region 660 678 N/A INTRINSIC
low complexity region 685 695 N/A INTRINSIC
low complexity region 700 720 N/A INTRINSIC
low complexity region 729 753 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175837
SMART Domains Protein: ENSMUSP00000134828
Gene: ENSMUSG00000021000

DomainStartEndE-ValueType
SCOP:d1fxkc_ 3 90 5e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000175877
SMART Domains Protein: ENSMUSP00000135440
Gene: ENSMUSG00000021000

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
SCOP:d1fxkc_ 74 203 1e-5 SMART
SCOP:d1fxkc_ 264 387 6e-16 SMART
low complexity region 430 443 N/A INTRINSIC
low complexity region 589 607 N/A INTRINSIC
low complexity region 614 624 N/A INTRINSIC
low complexity region 629 649 N/A INTRINSIC
low complexity region 658 682 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000175912
SMART Domains Protein: ENSMUSP00000135251
Gene: ENSMUSG00000021000

DomainStartEndE-ValueType
transmembrane domain 26 48 N/A INTRINSIC
SCOP:d1fxkc_ 115 244 8e-6 SMART
SCOP:d1fxkc_ 305 428 2e-16 SMART
low complexity region 471 484 N/A INTRINSIC
low complexity region 524 547 N/A INTRINSIC
low complexity region 673 691 N/A INTRINSIC
low complexity region 698 708 N/A INTRINSIC
low complexity region 713 733 N/A INTRINSIC
low complexity region 742 766 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000176322
SMART Domains Protein: ENSMUSP00000135100
Gene: ENSMUSG00000021000

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
transmembrane domain 37 59 N/A INTRINSIC
SCOP:d1fxkc_ 135 264 4e-6 SMART
SCOP:d1fxkc_ 325 448 9e-17 SMART
low complexity region 491 504 N/A INTRINSIC
low complexity region 544 567 N/A INTRINSIC
low complexity region 693 711 N/A INTRINSIC
low complexity region 718 728 N/A INTRINSIC
low complexity region 733 753 N/A INTRINSIC
low complexity region 762 786 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176336
SMART Domains Protein: ENSMUSP00000134872
Gene: ENSMUSG00000021000

DomainStartEndE-ValueType
transmembrane domain 7 24 N/A INTRINSIC
coiled coil region 55 235 N/A INTRINSIC
SCOP:d1fxkc_ 281 404 6e-8 SMART
low complexity region 447 460 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000176464
SMART Domains Protein: ENSMUSP00000135390
Gene: ENSMUSG00000021000

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
transmembrane domain 37 59 N/A INTRINSIC
SCOP:d1fxkc_ 126 255 4e-6 SMART
SCOP:d1fxkc_ 316 439 8e-17 SMART
low complexity region 482 495 N/A INTRINSIC
low complexity region 535 558 N/A INTRINSIC
low complexity region 684 702 N/A INTRINSIC
low complexity region 709 719 N/A INTRINSIC
low complexity region 724 744 N/A INTRINSIC
low complexity region 753 777 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176617
Predicted Effect probably benign
Transcript: ENSMUST00000176727
SMART Domains Protein: ENSMUSP00000135694
Gene: ENSMUSG00000021000

DomainStartEndE-ValueType
transmembrane domain 26 48 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176752
SMART Domains Protein: ENSMUSP00000134972
Gene: ENSMUSG00000021000

DomainStartEndE-ValueType
transmembrane domain 26 48 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000176892
SMART Domains Protein: ENSMUSP00000135245
Gene: ENSMUSG00000021000

DomainStartEndE-ValueType
transmembrane domain 26 48 N/A INTRINSIC
SCOP:d1fxkc_ 91 220 4e-6 SMART
SCOP:d1fxkc_ 281 404 8e-17 SMART
low complexity region 447 460 N/A INTRINSIC
low complexity region 500 523 N/A INTRINSIC
low complexity region 649 667 N/A INTRINSIC
low complexity region 674 684 N/A INTRINSIC
low complexity region 689 709 N/A INTRINSIC
low complexity region 718 742 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000177162
SMART Domains Protein: ENSMUSP00000135001
Gene: ENSMUSG00000021000

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
transmembrane domain 37 59 N/A INTRINSIC
SCOP:d1fxkc_ 126 255 2e-5 SMART
SCOP:d1fxkc_ 316 439 8e-16 SMART
low complexity region 482 495 N/A INTRINSIC
low complexity region 641 659 N/A INTRINSIC
low complexity region 666 676 N/A INTRINSIC
low complexity region 681 701 N/A INTRINSIC
low complexity region 710 734 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000177225
SMART Domains Protein: ENSMUSP00000135618
Gene: ENSMUSG00000021000

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
SCOP:d1fxkc_ 98 227 3e-5 SMART
SCOP:d1fxkc_ 288 411 2e-15 SMART
low complexity region 454 467 N/A INTRINSIC
low complexity region 613 631 N/A INTRINSIC
low complexity region 638 648 N/A INTRINSIC
low complexity region 653 673 N/A INTRINSIC
low complexity region 682 706 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000219140
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein that is involved in endoplasmic reticulum-to-Golgi trafficking and regulation of cholesterol metabolism. Three major classes of transcripts are generated from this gene- melanoma inhibitory activity 2-specific transcripts, cTAGE family member 5-specific transcripts and transcripts that include exons from both these transcript species. Additionally, alternative splicing in these transcripts results in multiple transcript variants encoding diverse isoforms. A mutation in this gene (couch-potato or cpto) may result in low levels of plasma cholesterol and triglycerides. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit decreased serum levels of cholesterol, HDL cholesterol, triglyceride, and VLDL triglyceride. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430069I07Rik T C 15: 34,355,553 E51G possibly damaging Het
9530053A07Rik A C 7: 28,140,220 D486A probably benign Het
Abca14 C A 7: 120,289,609 C1259* probably null Het
Ablim1 T C 19: 57,215,908 E17G probably benign Het
Acsf3 G A 8: 122,813,577 V505I probably benign Het
Actn1 T C 12: 80,174,085 M650V probably benign Het
Adamts4 G A 1: 171,256,528 V525I probably benign Het
Adh1 T C 3: 138,282,808 Y181H probably damaging Het
Alpl G A 4: 137,752,698 R168W probably damaging Het
Ate1 T G 7: 130,519,931 K11Q probably benign Het
Atpaf1 T A 4: 115,811,091 F314L probably damaging Het
Baiap3 T A 17: 25,244,317 D1004V probably damaging Het
Bpifb9a C T 2: 154,267,696 T504M probably damaging Het
C1s2 T A 6: 124,625,384 I623F probably benign Het
Card11 T C 5: 140,901,070 D308G probably damaging Het
Cul9 C T 17: 46,540,433 V354I probably benign Het
Dnah1 A T 14: 31,298,705 F1236I probably damaging Het
Dync2h1 T A 9: 6,929,590 I4266F possibly damaging Het
Ear10 A T 14: 43,922,920 V150D probably damaging Het
Elfn2 C T 15: 78,672,983 A455T probably benign Het
Erp44 A G 4: 48,208,792 Y223H probably damaging Het
Fam110b T A 4: 5,798,895 H104Q probably benign Het
Fcgbp A G 7: 28,101,392 N1288D probably benign Het
Fcrl1 T C 3: 87,385,781 probably null Het
Fmo2 G T 1: 162,887,702 P117Q probably benign Het
Fsip2 A G 2: 82,980,519 K2394R possibly damaging Het
Gab1 T G 8: 80,800,151 K106T probably damaging Het
Gatad2b T C 3: 90,351,414 V248A probably damaging Het
Gemin6 T C 17: 80,227,775 S55P possibly damaging Het
Gfm2 G A 13: 97,175,024 V701I probably benign Het
Gm3250 T C 10: 77,782,227 T106A unknown Het
Gm7356 T C 17: 14,001,581 N62S probably benign Het
Gsdmc4 T C 15: 63,902,840 T31A possibly damaging Het
H2-M10.1 T A 17: 36,325,729 D61V probably damaging Het
Heatr5a A G 12: 51,925,339 L716S probably damaging Het
Hecw2 A G 1: 53,914,594 Y831H probably damaging Het
Ifi202b C T 1: 173,974,815 S151N probably benign Het
Il15ra C T 2: 11,718,381 T72I probably damaging Het
Ints1 A G 5: 139,765,074 L858P probably damaging Het
Kat2a C T 11: 100,710,900 V230I possibly damaging Het
Kcnq2 A T 2: 181,088,379 I498N possibly damaging Het
Kif26b C T 1: 178,679,046 T229I possibly damaging Het
Ly75 T A 2: 60,329,993 I957F probably damaging Het
Map3k12 T A 15: 102,502,166 R459W probably damaging Het
Mrgprf A G 7: 145,307,469 I53V unknown Het
Mttp A G 3: 138,091,203 L846P probably damaging Het
Myrip C T 9: 120,417,141 L112F probably damaging Het
Nav1 A G 1: 135,465,859 F1047S probably damaging Het
Nfkbib T C 7: 28,759,203 D327G possibly damaging Het
Notch1 C T 2: 26,476,375 V776I probably benign Het
Obsl1 G T 1: 75,489,517 D1522E probably damaging Het
Olfr1464-ps1 A T 19: 13,282,153 F302I unknown Het
Olfr605 T A 7: 103,442,788 M112L probably benign Het
Olfr823 T C 10: 130,112,224 K189E probably benign Het
Olfr859 T C 9: 19,808,648 M110T possibly damaging Het
Pde7a T C 3: 19,227,674 N471D probably benign Het
Pla2r1 T C 2: 60,530,435 H203R probably benign Het
Plch2 C A 4: 154,998,472 C573F probably damaging Het
Polr1a G A 6: 71,941,456 R666Q probably benign Het
Prepl T C 17: 85,081,240 N145S probably benign Het
Psen2 C T 1: 180,238,956 V139M probably benign Het
Ptgdr A T 14: 44,859,192 M21K possibly damaging Het
Rapgef6 T C 11: 54,691,239 W1331R probably benign Het
Rp1l1 G A 14: 64,032,298 G1778S probably benign Het
Rrbp1 A T 2: 143,969,462 M824K probably benign Het
Sel1l T C 12: 91,848,965 T23A probably benign Het
Sele A G 1: 164,053,868 S515G possibly damaging Het
Slc22a23 T C 13: 34,197,839 N421D probably damaging Het
Slc35f3 T G 8: 126,394,558 L386R probably benign Het
Stab2 G A 10: 86,946,220 S699L probably damaging Het
Synrg A T 11: 84,009,381 L726F probably damaging Het
Syt3 G A 7: 44,395,919 V528M probably damaging Het
Szt2 A G 4: 118,391,249 I655T probably damaging Het
Tbr1 T C 2: 61,812,256 S622P probably damaging Het
Tex36 C T 7: 133,587,223 G207S probably benign Het
Trav5n-4 G A 14: 53,312,942 W13* probably null Het
Trdn A T 10: 33,437,736 E500V probably null Het
Ugt2b38 A T 5: 87,411,895 N379K probably damaging Het
Unc13d T C 11: 116,074,050 R248G possibly damaging Het
Vmn1r195 C T 13: 22,278,749 L130F probably damaging Het
Vmn2r110 T C 17: 20,574,209 I733V probably benign Het
Zfp870 T A 17: 32,883,854 N167I probably damaging Het
Zmynd10 A T 9: 107,549,304 M179L probably benign Het
Other mutations in Mia2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00717:Mia2 APN 12 59160273 splice site probably benign
IGL00791:Mia2 APN 12 59108299 missense possibly damaging 0.82
IGL00821:Mia2 APN 12 59170320 critical splice donor site probably null
IGL00901:Mia2 APN 12 59108029 missense probably damaging 1.00
IGL00985:Mia2 APN 12 59188360 missense probably damaging 1.00
IGL01304:Mia2 APN 12 59104538 missense probably damaging 1.00
IGL01909:Mia2 APN 12 59107945 missense possibly damaging 0.94
IGL02646:Mia2 APN 12 59108836 missense probably damaging 1.00
IGL02800:Mia2 APN 12 59188491 nonsense probably null
IGL03332:Mia2 APN 12 59108398 missense probably damaging 0.97
PIT4812001:Mia2 UTSW 12 59101579 missense possibly damaging 0.92
R0242:Mia2 UTSW 12 59108856 missense probably damaging 1.00
R0242:Mia2 UTSW 12 59108856 missense probably damaging 1.00
R0449:Mia2 UTSW 12 59172594 critical splice donor site probably null
R0620:Mia2 UTSW 12 59154419 missense possibly damaging 0.96
R0622:Mia2 UTSW 12 59131578 missense probably damaging 0.98
R0632:Mia2 UTSW 12 59136143 missense probably damaging 0.99
R1643:Mia2 UTSW 12 59179845 splice site probably null
R1654:Mia2 UTSW 12 59108833 missense possibly damaging 0.92
R1706:Mia2 UTSW 12 59144766 nonsense probably null
R1776:Mia2 UTSW 12 59149575 splice site probably benign
R1848:Mia2 UTSW 12 59170251 splice site probably benign
R2240:Mia2 UTSW 12 59107882 missense probably benign 0.01
R2698:Mia2 UTSW 12 59170994 critical splice donor site probably null
R2860:Mia2 UTSW 12 59154410 missense probably damaging 0.98
R2861:Mia2 UTSW 12 59154410 missense probably damaging 0.98
R2862:Mia2 UTSW 12 59154410 missense probably damaging 0.98
R3429:Mia2 UTSW 12 59189641 missense possibly damaging 0.89
R3861:Mia2 UTSW 12 59109021 missense probably benign 0.00
R3965:Mia2 UTSW 12 59176372 missense probably damaging 1.00
R5156:Mia2 UTSW 12 59172537 missense possibly damaging 0.94
R5249:Mia2 UTSW 12 59108125 missense probably damaging 0.99
R5330:Mia2 UTSW 12 59095812 missense probably benign 0.01
R5331:Mia2 UTSW 12 59095812 missense probably benign 0.01
R5815:Mia2 UTSW 12 59174106 missense possibly damaging 0.95
R5972:Mia2 UTSW 12 59146937 missense probably damaging 1.00
R6651:Mia2 UTSW 12 59154362 missense possibly damaging 0.78
R6676:Mia2 UTSW 12 59108370 missense probably damaging 0.97
R6695:Mia2 UTSW 12 59172580 missense probably damaging 0.99
R6800:Mia2 UTSW 12 59188546 critical splice donor site probably null
R6845:Mia2 UTSW 12 59184278 nonsense probably null
R6919:Mia2 UTSW 12 59129895 missense possibly damaging 0.74
R7058:Mia2 UTSW 12 59184235 missense possibly damaging 0.77
R7209:Mia2 UTSW 12 59154390 missense possibly damaging 0.55
R7274:Mia2 UTSW 12 59108119 missense probably damaging 0.99
R7874:Mia2 UTSW 12 59108588 missense probably damaging 0.99
R7894:Mia2 UTSW 12 59189647 missense probably damaging 1.00
R7961:Mia2 UTSW 12 59159639 critical splice donor site probably null
R7980:Mia2 UTSW 12 59108865 missense probably damaging 0.98
R8110:Mia2 UTSW 12 59109087 splice site probably null
R8557:Mia2 UTSW 12 59101488 missense probably damaging 0.97
X0063:Mia2 UTSW 12 59136139 missense probably damaging 0.99
Z1176:Mia2 UTSW 12 59108124 missense probably benign 0.27
Z1176:Mia2 UTSW 12 59108801 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCGACCTCGGTACATTGC -3'
(R):5'- AACCTGAAAACTAGCCTCTGTG -3'

Sequencing Primer
(F):5'- GACCTCGGTACATTGCTAACTTG -3'
(R):5'- TGAAAACTAGCCTCTGTGAAGAC -3'
Posted On2019-06-26