Incidental Mutation 'R7291:Mia2'
ID 566432
Institutional Source Beutler Lab
Gene Symbol Mia2
Ensembl Gene ENSMUSG00000021000
Gene Name MIA SH3 domain ER export factor 2
Synonyms MEA6, Mgea, Mgea6, D12Bwg0579e, Ctage5
MMRRC Submission 045322-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.947) question?
Stock # R7291 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 59142368-59237006 bp(+) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 59205155 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135245 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069430] [ENSMUST00000170992] [ENSMUST00000175877] [ENSMUST00000175912] [ENSMUST00000176322] [ENSMUST00000176336] [ENSMUST00000176464] [ENSMUST00000176892] [ENSMUST00000176727] [ENSMUST00000176752] [ENSMUST00000177162] [ENSMUST00000177225] [ENSMUST00000219140]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000069430
SMART Domains Protein: ENSMUSP00000070572
Gene: ENSMUSG00000021000

DomainStartEndE-ValueType
transmembrane domain 26 48 N/A INTRINSIC
SCOP:d1fxkc_ 124 253 9e-6 SMART
SCOP:d1fxkc_ 314 437 3e-16 SMART
low complexity region 480 493 N/A INTRINSIC
low complexity region 533 556 N/A INTRINSIC
low complexity region 682 700 N/A INTRINSIC
low complexity region 707 717 N/A INTRINSIC
low complexity region 722 742 N/A INTRINSIC
low complexity region 751 775 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000170992
SMART Domains Protein: ENSMUSP00000126538
Gene: ENSMUSG00000021000

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
transmembrane domain 37 59 N/A INTRINSIC
SCOP:d1fxkc_ 102 231 2e-6 SMART
SCOP:d1fxkc_ 292 415 2e-17 SMART
low complexity region 458 471 N/A INTRINSIC
low complexity region 511 534 N/A INTRINSIC
low complexity region 660 678 N/A INTRINSIC
low complexity region 685 695 N/A INTRINSIC
low complexity region 700 720 N/A INTRINSIC
low complexity region 729 753 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175837
SMART Domains Protein: ENSMUSP00000134828
Gene: ENSMUSG00000021000

DomainStartEndE-ValueType
SCOP:d1fxkc_ 3 90 5e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000175877
SMART Domains Protein: ENSMUSP00000135440
Gene: ENSMUSG00000021000

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
SCOP:d1fxkc_ 74 203 1e-5 SMART
SCOP:d1fxkc_ 264 387 6e-16 SMART
low complexity region 430 443 N/A INTRINSIC
low complexity region 589 607 N/A INTRINSIC
low complexity region 614 624 N/A INTRINSIC
low complexity region 629 649 N/A INTRINSIC
low complexity region 658 682 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000175912
SMART Domains Protein: ENSMUSP00000135251
Gene: ENSMUSG00000021000

DomainStartEndE-ValueType
transmembrane domain 26 48 N/A INTRINSIC
SCOP:d1fxkc_ 115 244 8e-6 SMART
SCOP:d1fxkc_ 305 428 2e-16 SMART
low complexity region 471 484 N/A INTRINSIC
low complexity region 524 547 N/A INTRINSIC
low complexity region 673 691 N/A INTRINSIC
low complexity region 698 708 N/A INTRINSIC
low complexity region 713 733 N/A INTRINSIC
low complexity region 742 766 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000176322
SMART Domains Protein: ENSMUSP00000135100
Gene: ENSMUSG00000021000

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
transmembrane domain 37 59 N/A INTRINSIC
SCOP:d1fxkc_ 135 264 4e-6 SMART
SCOP:d1fxkc_ 325 448 9e-17 SMART
low complexity region 491 504 N/A INTRINSIC
low complexity region 544 567 N/A INTRINSIC
low complexity region 693 711 N/A INTRINSIC
low complexity region 718 728 N/A INTRINSIC
low complexity region 733 753 N/A INTRINSIC
low complexity region 762 786 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176336
SMART Domains Protein: ENSMUSP00000134872
Gene: ENSMUSG00000021000

DomainStartEndE-ValueType
transmembrane domain 7 24 N/A INTRINSIC
coiled coil region 55 235 N/A INTRINSIC
SCOP:d1fxkc_ 281 404 6e-8 SMART
low complexity region 447 460 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000176464
SMART Domains Protein: ENSMUSP00000135390
Gene: ENSMUSG00000021000

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
transmembrane domain 37 59 N/A INTRINSIC
SCOP:d1fxkc_ 126 255 4e-6 SMART
SCOP:d1fxkc_ 316 439 8e-17 SMART
low complexity region 482 495 N/A INTRINSIC
low complexity region 535 558 N/A INTRINSIC
low complexity region 684 702 N/A INTRINSIC
low complexity region 709 719 N/A INTRINSIC
low complexity region 724 744 N/A INTRINSIC
low complexity region 753 777 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176617
Predicted Effect probably null
Transcript: ENSMUST00000176892
SMART Domains Protein: ENSMUSP00000135245
Gene: ENSMUSG00000021000

DomainStartEndE-ValueType
transmembrane domain 26 48 N/A INTRINSIC
SCOP:d1fxkc_ 91 220 4e-6 SMART
SCOP:d1fxkc_ 281 404 8e-17 SMART
low complexity region 447 460 N/A INTRINSIC
low complexity region 500 523 N/A INTRINSIC
low complexity region 649 667 N/A INTRINSIC
low complexity region 674 684 N/A INTRINSIC
low complexity region 689 709 N/A INTRINSIC
low complexity region 718 742 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176727
SMART Domains Protein: ENSMUSP00000135694
Gene: ENSMUSG00000021000

DomainStartEndE-ValueType
transmembrane domain 26 48 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176752
SMART Domains Protein: ENSMUSP00000134972
Gene: ENSMUSG00000021000

DomainStartEndE-ValueType
transmembrane domain 26 48 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000177162
SMART Domains Protein: ENSMUSP00000135001
Gene: ENSMUSG00000021000

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
transmembrane domain 37 59 N/A INTRINSIC
SCOP:d1fxkc_ 126 255 2e-5 SMART
SCOP:d1fxkc_ 316 439 8e-16 SMART
low complexity region 482 495 N/A INTRINSIC
low complexity region 641 659 N/A INTRINSIC
low complexity region 666 676 N/A INTRINSIC
low complexity region 681 701 N/A INTRINSIC
low complexity region 710 734 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000177225
SMART Domains Protein: ENSMUSP00000135618
Gene: ENSMUSG00000021000

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
SCOP:d1fxkc_ 98 227 3e-5 SMART
SCOP:d1fxkc_ 288 411 2e-15 SMART
low complexity region 454 467 N/A INTRINSIC
low complexity region 613 631 N/A INTRINSIC
low complexity region 638 648 N/A INTRINSIC
low complexity region 653 673 N/A INTRINSIC
low complexity region 682 706 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000219140
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein that is involved in endoplasmic reticulum-to-Golgi trafficking and regulation of cholesterol metabolism. Three major classes of transcripts are generated from this gene- melanoma inhibitory activity 2-specific transcripts, cTAGE family member 5-specific transcripts and transcripts that include exons from both these transcript species. Additionally, alternative splicing in these transcripts results in multiple transcript variants encoding diverse isoforms. A mutation in this gene (couch-potato or cpto) may result in low levels of plasma cholesterol and triglycerides. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit decreased serum levels of cholesterol, HDL cholesterol, triglyceride, and VLDL triglyceride. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430069I07Rik T C 15: 34,355,699 (GRCm39) E51G possibly damaging Het
Abca14 C A 7: 119,888,832 (GRCm39) C1259* probably null Het
Ablim1 T C 19: 57,204,340 (GRCm39) E17G probably benign Het
Acsf3 G A 8: 123,540,316 (GRCm39) V505I probably benign Het
Actn1 T C 12: 80,220,859 (GRCm39) M650V probably benign Het
Adamts4 G A 1: 171,084,097 (GRCm39) V525I probably benign Het
Adh1 T C 3: 137,988,569 (GRCm39) Y181H probably damaging Het
Alpl G A 4: 137,480,009 (GRCm39) R168W probably damaging Het
Ate1 T G 7: 130,121,661 (GRCm39) K11Q probably benign Het
Atpaf1 T A 4: 115,668,288 (GRCm39) F314L probably damaging Het
Baiap3 T A 17: 25,463,291 (GRCm39) D1004V probably damaging Het
Bpifb9a C T 2: 154,109,616 (GRCm39) T504M probably damaging Het
C1s2 T A 6: 124,602,343 (GRCm39) I623F probably benign Het
Card11 T C 5: 140,886,825 (GRCm39) D308G probably damaging Het
Cul9 C T 17: 46,851,359 (GRCm39) V354I probably benign Het
Dnah1 A T 14: 31,020,662 (GRCm39) F1236I probably damaging Het
Dync2h1 T A 9: 6,929,590 (GRCm39) I4266F possibly damaging Het
Ear10 A T 14: 44,160,377 (GRCm39) V150D probably damaging Het
Elfn2 C T 15: 78,557,183 (GRCm39) A455T probably benign Het
Erp44 A G 4: 48,208,792 (GRCm39) Y223H probably damaging Het
Fam110b T A 4: 5,798,895 (GRCm39) H104Q probably benign Het
Fcgbp A G 7: 27,800,817 (GRCm39) N1288D probably benign Het
Fcgbpl1 A C 7: 27,839,645 (GRCm39) D486A probably benign Het
Fcrl1 T C 3: 87,293,088 (GRCm39) probably null Het
Fmo2 G T 1: 162,715,271 (GRCm39) P117Q probably benign Het
Fsip2 A G 2: 82,810,863 (GRCm39) K2394R possibly damaging Het
Gab1 T G 8: 81,526,780 (GRCm39) K106T probably damaging Het
Gatad2b T C 3: 90,258,721 (GRCm39) V248A probably damaging Het
Gemin6 T C 17: 80,535,204 (GRCm39) S55P possibly damaging Het
Gfm2 G A 13: 97,311,532 (GRCm39) V701I probably benign Het
Gm3250 T C 10: 77,618,061 (GRCm39) T106A unknown Het
Gm7356 T C 17: 14,221,843 (GRCm39) N62S probably benign Het
Gsdmc4 T C 15: 63,774,689 (GRCm39) T31A possibly damaging Het
H2-M10.1 T A 17: 36,636,621 (GRCm39) D61V probably damaging Het
Heatr5a A G 12: 51,972,122 (GRCm39) L716S probably damaging Het
Hecw2 A G 1: 53,953,753 (GRCm39) Y831H probably damaging Het
Ifi202b C T 1: 173,802,381 (GRCm39) S151N probably benign Het
Il15ra C T 2: 11,723,192 (GRCm39) T72I probably damaging Het
Ints1 A G 5: 139,750,829 (GRCm39) L858P probably damaging Het
Kat2a C T 11: 100,601,726 (GRCm39) V230I possibly damaging Het
Kcnq2 A T 2: 180,730,172 (GRCm39) I498N possibly damaging Het
Kif26b C T 1: 178,506,611 (GRCm39) T229I possibly damaging Het
Ly75 T A 2: 60,160,337 (GRCm39) I957F probably damaging Het
Map3k12 T A 15: 102,410,601 (GRCm39) R459W probably damaging Het
Mrgprf A G 7: 144,861,206 (GRCm39) I53V unknown Het
Mttp A G 3: 137,796,964 (GRCm39) L846P probably damaging Het
Myrip C T 9: 120,246,207 (GRCm39) L112F probably damaging Het
Nav1 A G 1: 135,393,597 (GRCm39) F1047S probably damaging Het
Nfkbib T C 7: 28,458,628 (GRCm39) D327G possibly damaging Het
Notch1 C T 2: 26,366,387 (GRCm39) V776I probably benign Het
Obsl1 G T 1: 75,466,161 (GRCm39) D1522E probably damaging Het
Or52s6 T A 7: 103,091,995 (GRCm39) M112L probably benign Het
Or5b110-ps1 A T 19: 13,259,517 (GRCm39) F302I unknown Het
Or7e168 T C 9: 19,719,944 (GRCm39) M110T possibly damaging Het
Or9r3 T C 10: 129,948,093 (GRCm39) K189E probably benign Het
Pde7a T C 3: 19,281,838 (GRCm39) N471D probably benign Het
Pla2r1 T C 2: 60,360,779 (GRCm39) H203R probably benign Het
Plch2 C A 4: 155,082,929 (GRCm39) C573F probably damaging Het
Polr1a G A 6: 71,918,440 (GRCm39) R666Q probably benign Het
Prepl T C 17: 85,388,668 (GRCm39) N145S probably benign Het
Psen2 C T 1: 180,066,521 (GRCm39) V139M probably benign Het
Ptgdr A T 14: 45,096,649 (GRCm39) M21K possibly damaging Het
Rapgef6 T C 11: 54,582,065 (GRCm39) W1331R probably benign Het
Rp1l1 G A 14: 64,269,747 (GRCm39) G1778S probably benign Het
Rrbp1 A T 2: 143,811,382 (GRCm39) M824K probably benign Het
Sel1l T C 12: 91,815,739 (GRCm39) T23A probably benign Het
Sele A G 1: 163,881,437 (GRCm39) S515G possibly damaging Het
Slc22a23 T C 13: 34,381,822 (GRCm39) N421D probably damaging Het
Slc35f3 T G 8: 127,121,297 (GRCm39) L386R probably benign Het
Stab2 G A 10: 86,782,084 (GRCm39) S699L probably damaging Het
Synrg A T 11: 83,900,207 (GRCm39) L726F probably damaging Het
Syt3 G A 7: 44,045,343 (GRCm39) V528M probably damaging Het
Szt2 A G 4: 118,248,446 (GRCm39) I655T probably damaging Het
Tbr1 T C 2: 61,642,600 (GRCm39) S622P probably damaging Het
Tex36 C T 7: 133,188,952 (GRCm39) G207S probably benign Het
Trav5n-4 G A 14: 53,550,399 (GRCm39) W13* probably null Het
Trdn A T 10: 33,313,732 (GRCm39) E500V probably null Het
Ugt2b38 A T 5: 87,559,754 (GRCm39) N379K probably damaging Het
Unc13d T C 11: 115,964,876 (GRCm39) R248G possibly damaging Het
Vmn1r195 C T 13: 22,462,919 (GRCm39) L130F probably damaging Het
Vmn2r110 T C 17: 20,794,471 (GRCm39) I733V probably benign Het
Zfp870 T A 17: 33,102,828 (GRCm39) N167I probably damaging Het
Zmynd10 A T 9: 107,426,503 (GRCm39) M179L probably benign Het
Other mutations in Mia2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00717:Mia2 APN 12 59,207,059 (GRCm39) splice site probably benign
IGL00791:Mia2 APN 12 59,155,085 (GRCm39) missense possibly damaging 0.82
IGL00821:Mia2 APN 12 59,217,106 (GRCm39) critical splice donor site probably null
IGL00901:Mia2 APN 12 59,154,815 (GRCm39) missense probably damaging 1.00
IGL00985:Mia2 APN 12 59,235,146 (GRCm39) missense probably damaging 1.00
IGL01304:Mia2 APN 12 59,151,324 (GRCm39) missense probably damaging 1.00
IGL01909:Mia2 APN 12 59,154,731 (GRCm39) missense possibly damaging 0.94
IGL02646:Mia2 APN 12 59,155,622 (GRCm39) missense probably damaging 1.00
IGL02800:Mia2 APN 12 59,235,277 (GRCm39) nonsense probably null
IGL03332:Mia2 APN 12 59,155,184 (GRCm39) missense probably damaging 0.97
PIT4812001:Mia2 UTSW 12 59,148,365 (GRCm39) missense possibly damaging 0.92
R0242:Mia2 UTSW 12 59,155,642 (GRCm39) missense probably damaging 1.00
R0242:Mia2 UTSW 12 59,155,642 (GRCm39) missense probably damaging 1.00
R0449:Mia2 UTSW 12 59,219,380 (GRCm39) critical splice donor site probably null
R0620:Mia2 UTSW 12 59,201,205 (GRCm39) missense possibly damaging 0.96
R0622:Mia2 UTSW 12 59,178,364 (GRCm39) missense probably damaging 0.98
R0632:Mia2 UTSW 12 59,182,929 (GRCm39) missense probably damaging 0.99
R1643:Mia2 UTSW 12 59,226,631 (GRCm39) splice site probably null
R1654:Mia2 UTSW 12 59,155,619 (GRCm39) missense possibly damaging 0.92
R1706:Mia2 UTSW 12 59,191,552 (GRCm39) nonsense probably null
R1776:Mia2 UTSW 12 59,196,361 (GRCm39) splice site probably benign
R1848:Mia2 UTSW 12 59,217,037 (GRCm39) splice site probably benign
R2240:Mia2 UTSW 12 59,154,668 (GRCm39) missense probably benign 0.01
R2698:Mia2 UTSW 12 59,217,780 (GRCm39) critical splice donor site probably null
R2860:Mia2 UTSW 12 59,201,196 (GRCm39) missense probably damaging 0.98
R2861:Mia2 UTSW 12 59,201,196 (GRCm39) missense probably damaging 0.98
R2862:Mia2 UTSW 12 59,201,196 (GRCm39) missense probably damaging 0.98
R3429:Mia2 UTSW 12 59,236,427 (GRCm39) missense possibly damaging 0.89
R3861:Mia2 UTSW 12 59,155,807 (GRCm39) missense probably benign 0.00
R3965:Mia2 UTSW 12 59,223,158 (GRCm39) missense probably damaging 1.00
R5156:Mia2 UTSW 12 59,219,323 (GRCm39) missense possibly damaging 0.94
R5249:Mia2 UTSW 12 59,154,911 (GRCm39) missense probably damaging 0.99
R5330:Mia2 UTSW 12 59,142,598 (GRCm39) missense probably benign 0.01
R5331:Mia2 UTSW 12 59,142,598 (GRCm39) missense probably benign 0.01
R5815:Mia2 UTSW 12 59,220,892 (GRCm39) missense possibly damaging 0.95
R5972:Mia2 UTSW 12 59,193,723 (GRCm39) missense probably damaging 1.00
R6651:Mia2 UTSW 12 59,201,148 (GRCm39) missense possibly damaging 0.78
R6676:Mia2 UTSW 12 59,155,156 (GRCm39) missense probably damaging 0.97
R6695:Mia2 UTSW 12 59,219,366 (GRCm39) missense probably damaging 0.99
R6800:Mia2 UTSW 12 59,235,332 (GRCm39) critical splice donor site probably null
R6845:Mia2 UTSW 12 59,231,064 (GRCm39) nonsense probably null
R6919:Mia2 UTSW 12 59,176,681 (GRCm39) missense possibly damaging 0.74
R7058:Mia2 UTSW 12 59,231,021 (GRCm39) missense possibly damaging 0.77
R7209:Mia2 UTSW 12 59,201,176 (GRCm39) missense possibly damaging 0.55
R7274:Mia2 UTSW 12 59,154,905 (GRCm39) missense probably damaging 0.99
R7874:Mia2 UTSW 12 59,155,374 (GRCm39) missense probably damaging 0.99
R7894:Mia2 UTSW 12 59,236,433 (GRCm39) missense probably damaging 1.00
R7961:Mia2 UTSW 12 59,206,425 (GRCm39) critical splice donor site probably null
R7980:Mia2 UTSW 12 59,155,651 (GRCm39) missense probably damaging 0.98
R8110:Mia2 UTSW 12 59,155,873 (GRCm39) splice site probably null
R8557:Mia2 UTSW 12 59,148,274 (GRCm39) missense probably damaging 0.97
R9031:Mia2 UTSW 12 59,155,586 (GRCm39) missense probably damaging 1.00
R9077:Mia2 UTSW 12 59,226,760 (GRCm39) missense possibly damaging 0.94
R9113:Mia2 UTSW 12 59,217,053 (GRCm39) utr 3 prime probably benign
R9214:Mia2 UTSW 12 59,223,150 (GRCm39) missense possibly damaging 0.92
R9433:Mia2 UTSW 12 59,148,371 (GRCm39) missense probably damaging 1.00
X0063:Mia2 UTSW 12 59,182,925 (GRCm39) missense probably damaging 0.99
Z1176:Mia2 UTSW 12 59,155,587 (GRCm39) missense probably damaging 1.00
Z1176:Mia2 UTSW 12 59,154,910 (GRCm39) missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- ATCGACCTCGGTACATTGC -3'
(R):5'- AACCTGAAAACTAGCCTCTGTG -3'

Sequencing Primer
(F):5'- GACCTCGGTACATTGCTAACTTG -3'
(R):5'- TGAAAACTAGCCTCTGTGAAGAC -3'
Posted On 2019-06-26