Mutagenetix > Incidental Mutation

Incidental Mutation 'R7291:Actn1'

566433

Institutional Source

Beutler Lab

Gene Symbol

Actn1

Ensembl Gene

ENSMUSG00000015143

Gene Name

actinin, alpha 1

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.588) question?

Stock #

R7291 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

80167547-80260371 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 80174085 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Valine at position 650 (M650V)

Ref Sequence

ENSEMBL: ENSMUSP00000021554 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021554] [ENSMUST00000167327]

AlphaFold

Q7TPR4

Predicted Effect

probably benign
Transcript: ENSMUST00000021554
AA Change: M650V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000021554
Gene: ENSMUSG00000015143
AA Change: M650V

Domain	Start	End	E-Value	Type
CH	33	133	4.24e-23	SMART
CH	146	245	5.06e-21	SMART
Pfam:Spectrin	274	384	5.9e-17	PFAM
SPEC	397	498	1.69e-25	SMART
SPEC	512	619	1.47e-2	SMART
Pfam:Spectrin	630	733	4.7e-14	PFAM
EFh	750	778	1.73e-5	SMART
EFh	791	819	8.13e-2	SMART
efhand_Ca_insen	822	888	5.22e-38	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000167327
AA Change: M650V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000127176
Gene: ENSMUSG00000015143
AA Change: M650V

Domain	Start	End	E-Value	Type
CH	33	133	4.24e-23	SMART
CH	146	245	5.06e-21	SMART
Pfam:Spectrin	274	384	1.7e-17	PFAM
SPEC	397	498	1.69e-25	SMART
SPEC	512	619	1.47e-2	SMART
Pfam:Spectrin	630	733	8.4e-14	PFAM
EFh	750	778	1.36e0	SMART
EFh	786	814	8.13e-2	SMART
efhand_Ca_insen	817	883	5.22e-38	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Alpha actinins belong to the spectrin gene superfamily which represents a diverse group of cytoskeletal proteins, including the alpha and beta spectrins and dystrophins. Alpha actinin is an actin-binding protein with multiple roles in different cell types. In nonmuscle cells, the cytoskeletal isoform is found along microfilament bundles and adherens-type junctions, where it is involved in binding actin to the membrane. In contrast, skeletal, cardiac, and smooth muscle isoforms are localized to the Z-disc and analogous dense bodies, where they help anchor the myofibrillar actin filaments. This gene encodes a nonmuscle, cytoskeletal, alpha actinin isoform and maps to the same site as the structurally similar erythroid beta spectrin gene. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9430069I07Rik	T	C	15: 34,355,553	E51G	possibly damaging	Het
9530053A07Rik	A	C	7: 28,140,220	D486A	probably benign	Het
Abca14	C	A	7: 120,289,609	C1259*	probably null	Het
Ablim1	T	C	19: 57,215,908	E17G	probably benign	Het
Acsf3	G	A	8: 122,813,577	V505I	probably benign	Het
Adamts4	G	A	1: 171,256,528	V525I	probably benign	Het
Adh1	T	C	3: 138,282,808	Y181H	probably damaging	Het
Alpl	G	A	4: 137,752,698	R168W	probably damaging	Het
Ate1	T	G	7: 130,519,931	K11Q	probably benign	Het
Atpaf1	T	A	4: 115,811,091	F314L	probably damaging	Het
Baiap3	T	A	17: 25,244,317	D1004V	probably damaging	Het
Bpifb9a	C	T	2: 154,267,696	T504M	probably damaging	Het
C1s2	T	A	6: 124,625,384	I623F	probably benign	Het
Card11	T	C	5: 140,901,070	D308G	probably damaging	Het
Cul9	C	T	17: 46,540,433	V354I	probably benign	Het
Dnah1	A	T	14: 31,298,705	F1236I	probably damaging	Het
Dync2h1	T	A	9: 6,929,590	I4266F	possibly damaging	Het
Ear10	A	T	14: 43,922,920	V150D	probably damaging	Het
Elfn2	C	T	15: 78,672,983	A455T	probably benign	Het
Erp44	A	G	4: 48,208,792	Y223H	probably damaging	Het
Fam110b	T	A	4: 5,798,895	H104Q	probably benign	Het
Fcgbp	A	G	7: 28,101,392	N1288D	probably benign	Het
Fcrl1	T	C	3: 87,385,781		probably null	Het
Fmo2	G	T	1: 162,887,702	P117Q	probably benign	Het
Fsip2	A	G	2: 82,980,519	K2394R	possibly damaging	Het
Gab1	T	G	8: 80,800,151	K106T	probably damaging	Het
Gatad2b	T	C	3: 90,351,414	V248A	probably damaging	Het
Gemin6	T	C	17: 80,227,775	S55P	possibly damaging	Het
Gfm2	G	A	13: 97,175,024	V701I	probably benign	Het
Gm3250	T	C	10: 77,782,227	T106A	unknown	Het
Gm7356	T	C	17: 14,001,581	N62S	probably benign	Het
Gsdmc4	T	C	15: 63,902,840	T31A	possibly damaging	Het
H2-M10.1	T	A	17: 36,325,729	D61V	probably damaging	Het
Heatr5a	A	G	12: 51,925,339	L716S	probably damaging	Het
Hecw2	A	G	1: 53,914,594	Y831H	probably damaging	Het
Ifi202b	C	T	1: 173,974,815	S151N	probably benign	Het
Il15ra	C	T	2: 11,718,381	T72I	probably damaging	Het
Ints1	A	G	5: 139,765,074	L858P	probably damaging	Het
Kat2a	C	T	11: 100,710,900	V230I	possibly damaging	Het
Kcnq2	A	T	2: 181,088,379	I498N	possibly damaging	Het
Kif26b	C	T	1: 178,679,046	T229I	possibly damaging	Het
Ly75	T	A	2: 60,329,993	I957F	probably damaging	Het
Map3k12	T	A	15: 102,502,166	R459W	probably damaging	Het
Mia2	T	A	12: 59,158,369		probably null	Het
Mrgprf	A	G	7: 145,307,469	I53V	unknown	Het
Mttp	A	G	3: 138,091,203	L846P	probably damaging	Het
Myrip	C	T	9: 120,417,141	L112F	probably damaging	Het
Nav1	A	G	1: 135,465,859	F1047S	probably damaging	Het
Nfkbib	T	C	7: 28,759,203	D327G	possibly damaging	Het
Notch1	C	T	2: 26,476,375	V776I	probably benign	Het
Obsl1	G	T	1: 75,489,517	D1522E	probably damaging	Het
Olfr1464-ps1	A	T	19: 13,282,153	F302I	unknown	Het
Olfr605	T	A	7: 103,442,788	M112L	probably benign	Het
Olfr823	T	C	10: 130,112,224	K189E	probably benign	Het
Olfr859	T	C	9: 19,808,648	M110T	possibly damaging	Het
Pde7a	T	C	3: 19,227,674	N471D	probably benign	Het
Pla2r1	T	C	2: 60,530,435	H203R	probably benign	Het
Plch2	C	A	4: 154,998,472	C573F	probably damaging	Het
Polr1a	G	A	6: 71,941,456	R666Q	probably benign	Het
Prepl	T	C	17: 85,081,240	N145S	probably benign	Het
Psen2	C	T	1: 180,238,956	V139M	probably benign	Het
Ptgdr	A	T	14: 44,859,192	M21K	possibly damaging	Het
Rapgef6	T	C	11: 54,691,239	W1331R	probably benign	Het
Rp1l1	G	A	14: 64,032,298	G1778S	probably benign	Het
Rrbp1	A	T	2: 143,969,462	M824K	probably benign	Het
Sel1l	T	C	12: 91,848,965	T23A	probably benign	Het
Sele	A	G	1: 164,053,868	S515G	possibly damaging	Het
Slc22a23	T	C	13: 34,197,839	N421D	probably damaging	Het
Slc35f3	T	G	8: 126,394,558	L386R	probably benign	Het
Stab2	G	A	10: 86,946,220	S699L	probably damaging	Het
Synrg	A	T	11: 84,009,381	L726F	probably damaging	Het
Syt3	G	A	7: 44,395,919	V528M	probably damaging	Het
Szt2	A	G	4: 118,391,249	I655T	probably damaging	Het
Tbr1	T	C	2: 61,812,256	S622P	probably damaging	Het
Tex36	C	T	7: 133,587,223	G207S	probably benign	Het
Trav5n-4	G	A	14: 53,312,942	W13*	probably null	Het
Trdn	A	T	10: 33,437,736	E500V	probably null	Het
Ugt2b38	A	T	5: 87,411,895	N379K	probably damaging	Het
Unc13d	T	C	11: 116,074,050	R248G	possibly damaging	Het
Vmn1r195	C	T	13: 22,278,749	L130F	probably damaging	Het
Vmn2r110	T	C	17: 20,574,209	I733V	probably benign	Het
Zfp870	T	A	17: 32,883,854	N167I	probably damaging	Het
Zmynd10	A	T	9: 107,549,304	M179L	probably benign	Het

Other mutations in Actn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01090:Actn1	APN	12	80199072	splice site	probably null
IGL01152:Actn1	APN	12	80199046	missense	probably damaging	1.00
IGL01386:Actn1	APN	12	80193672	missense	probably benign	0.03
IGL01890:Actn1	APN	12	80184868	missense	probably damaging	0.99
IGL01937:Actn1	APN	12	80171763	missense	probably benign	0.03
IGL02142:Actn1	APN	12	80176155	critical splice donor site	probably null
IGL02191:Actn1	APN	12	80174109	missense	probably benign
IGL02217:Actn1	APN	12	80174094	nonsense	probably null
IGL02230:Actn1	APN	12	80171830	missense	probably benign	0.02
IGL03163:Actn1	APN	12	80181417	missense	probably benign	0.33
IGL03401:Actn1	APN	12	80168967	nonsense	probably null
R0538:Actn1	UTSW	12	80260100	unclassified	probably benign
R0546:Actn1	UTSW	12	80178434	missense	probably benign
R0583:Actn1	UTSW	12	80199029	missense	probably damaging	1.00
R0606:Actn1	UTSW	12	80174647	splice site	probably benign
R1340:Actn1	UTSW	12	80173144	critical splice acceptor site	probably null
R1519:Actn1	UTSW	12	80205078	missense	probably damaging	1.00
R1572:Actn1	UTSW	12	80172957	splice site	probably benign
R1619:Actn1	UTSW	12	80173022	missense	probably damaging	1.00
R1677:Actn1	UTSW	12	80260032	missense	probably benign	0.02
R1994:Actn1	UTSW	12	80204971	nonsense	probably null
R2102:Actn1	UTSW	12	80183517	missense	probably benign	0.38
R2157:Actn1	UTSW	12	80173117	missense	probably benign	0.04
R2191:Actn1	UTSW	12	80171802	nonsense	probably null
R2519:Actn1	UTSW	12	80192389	missense	probably damaging	1.00
R2988:Actn1	UTSW	12	80192388	missense	possibly damaging	0.78
R4024:Actn1	UTSW	12	80168477	missense	probably damaging	1.00
R4589:Actn1	UTSW	12	80171799	missense	possibly damaging	0.53
R4907:Actn1	UTSW	12	80181414	missense	probably damaging	0.99
R4936:Actn1	UTSW	12	80172998	missense	probably benign	0.09
R4966:Actn1	UTSW	12	80173130	missense	probably benign	0.01
R4972:Actn1	UTSW	12	80173039	missense	probably benign	0.35
R5395:Actn1	UTSW	12	80170703	missense	probably benign
R5460:Actn1	UTSW	12	80183568	missense	probably benign	0.00
R5467:Actn1	UTSW	12	80176217	missense	possibly damaging	0.86
R5470:Actn1	UTSW	12	80168941	missense	probably damaging	0.99
R5661:Actn1	UTSW	12	80184844	missense	probably benign	0.09
R5985:Actn1	UTSW	12	80168395	missense	probably damaging	1.00
R6020:Actn1	UTSW	12	80174455	splice site	probably null
R6042:Actn1	UTSW	12	80177249	missense	probably benign	0.04
R6389:Actn1	UTSW	12	80174522	missense	probably benign
R6499:Actn1	UTSW	12	80168417	missense	possibly damaging	0.59
R6709:Actn1	UTSW	12	80193644	missense	probably damaging	1.00
R7016:Actn1	UTSW	12	80172968	missense	possibly damaging	0.94
R7116:Actn1	UTSW	12	80204977	missense	probably damaging	1.00
R7173:Actn1	UTSW	12	80177259	missense	possibly damaging	0.70
R7183:Actn1	UTSW	12	80168932	missense	possibly damaging	0.87
R7361:Actn1	UTSW	12	80193715	missense	probably benign	0.01
R7452:Actn1	UTSW	12	80183602	missense	probably benign	0.12
R7698:Actn1	UTSW	12	80174537	missense	probably benign	0.00
R7701:Actn1	UTSW	12	80174554	missense	possibly damaging	0.88
R8000:Actn1	UTSW	12	80199008	missense	probably damaging	1.00
R8171:Actn1	UTSW	12	80196393	critical splice donor site	probably null
R8287:Actn1	UTSW	12	80174078	critical splice donor site	probably null
R8469:Actn1	UTSW	12	80193683	missense	possibly damaging	0.95
R8794:Actn1	UTSW	12	80198980	critical splice donor site	probably benign
R8887:Actn1	UTSW	12	80168423	missense	probably damaging	1.00
R9237:Actn1	UTSW	12	80193696	missense	possibly damaging	0.92
R9269:Actn1	UTSW	12	80172971	missense	probably benign	0.01
R9520:Actn1	UTSW	12	80193643	missense	probably damaging	1.00
R9526:Actn1	UTSW	12	80183619	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACTTTGCTCCAATCTGACAAAGG -3'
(R):5'- TCCCTTGCCACTCGAATGAC -3'

Sequencing Primer
(F):5'- TCTGACAAAGGGAGCAAACTGTC -3'
(R):5'- ACTCGAATGACCCCCATTTC -3'

Posted On

2019-06-26