Incidental Mutation 'R7291:Slc22a23'
ID566436
Institutional Source Beutler Lab
Gene Symbol Slc22a23
Ensembl Gene ENSMUSG00000038267
Gene Namesolute carrier family 22, member 23
Synonyms3110004L20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.173) question?
Stock #R7291 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location34179158-34345182 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34197839 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 421 (N421D)
Ref Sequence ENSEMBL: ENSMUSP00000042742 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040336]
Predicted Effect probably damaging
Transcript: ENSMUST00000040336
AA Change: N421D

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000042742
Gene: ENSMUSG00000038267
AA Change: N421D

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
low complexity region 153 164 N/A INTRINSIC
Pfam:Sugar_tr 187 633 5e-26 PFAM
Pfam:MFS_1 224 518 2.6e-13 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000122283
Gene: ENSMUSG00000038267
AA Change: N305D

DomainStartEndE-ValueType
low complexity region 38 49 N/A INTRINSIC
Pfam:Sugar_tr 71 510 1.4e-27 PFAM
Pfam:MFS_1 109 402 1.5e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC22A23 belongs to a large family of transmembrane proteins that function as uniporters, symporters, and antiporters to transport organic ions across cell membranes (Jacobsson et al., 2007 [PubMed 17714910]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430069I07Rik T C 15: 34,355,553 E51G possibly damaging Het
9530053A07Rik A C 7: 28,140,220 D486A probably benign Het
Abca14 C A 7: 120,289,609 C1259* probably null Het
Ablim1 T C 19: 57,215,908 E17G probably benign Het
Acsf3 G A 8: 122,813,577 V505I probably benign Het
Actn1 T C 12: 80,174,085 M650V probably benign Het
Adamts4 G A 1: 171,256,528 V525I probably benign Het
Adh1 T C 3: 138,282,808 Y181H probably damaging Het
Alpl G A 4: 137,752,698 R168W probably damaging Het
Ate1 T G 7: 130,519,931 K11Q probably benign Het
Atpaf1 T A 4: 115,811,091 F314L probably damaging Het
Baiap3 T A 17: 25,244,317 D1004V probably damaging Het
Bpifb9a C T 2: 154,267,696 T504M probably damaging Het
C1s2 T A 6: 124,625,384 I623F probably benign Het
Card11 T C 5: 140,901,070 D308G probably damaging Het
Cul9 C T 17: 46,540,433 V354I probably benign Het
Dnah1 A T 14: 31,298,705 F1236I probably damaging Het
Dync2h1 T A 9: 6,929,590 I4266F possibly damaging Het
Ear10 A T 14: 43,922,920 V150D probably damaging Het
Elfn2 C T 15: 78,672,983 A455T probably benign Het
Erp44 A G 4: 48,208,792 Y223H probably damaging Het
Fam110b T A 4: 5,798,895 H104Q probably benign Het
Fcgbp A G 7: 28,101,392 N1288D probably benign Het
Fcrl1 T C 3: 87,385,781 probably null Het
Fmo2 G T 1: 162,887,702 P117Q probably benign Het
Fsip2 A G 2: 82,980,519 K2394R possibly damaging Het
Gab1 T G 8: 80,800,151 K106T probably damaging Het
Gatad2b T C 3: 90,351,414 V248A probably damaging Het
Gemin6 T C 17: 80,227,775 S55P possibly damaging Het
Gfm2 G A 13: 97,175,024 V701I probably benign Het
Gm3250 T C 10: 77,782,227 T106A unknown Het
Gm7356 T C 17: 14,001,581 N62S probably benign Het
Gsdmc4 T C 15: 63,902,840 T31A possibly damaging Het
H2-M10.1 T A 17: 36,325,729 D61V probably damaging Het
Heatr5a A G 12: 51,925,339 L716S probably damaging Het
Hecw2 A G 1: 53,914,594 Y831H probably damaging Het
Ifi202b C T 1: 173,974,815 S151N probably benign Het
Il15ra C T 2: 11,718,381 T72I probably damaging Het
Ints1 A G 5: 139,765,074 L858P probably damaging Het
Kat2a C T 11: 100,710,900 V230I possibly damaging Het
Kcnq2 A T 2: 181,088,379 I498N possibly damaging Het
Kif26b C T 1: 178,679,046 T229I possibly damaging Het
Ly75 T A 2: 60,329,993 I957F probably damaging Het
Map3k12 T A 15: 102,502,166 R459W probably damaging Het
Mia2 T A 12: 59,158,369 probably null Het
Mrgprf A G 7: 145,307,469 I53V unknown Het
Mttp A G 3: 138,091,203 L846P probably damaging Het
Myrip C T 9: 120,417,141 L112F probably damaging Het
Nav1 A G 1: 135,465,859 F1047S probably damaging Het
Nfkbib T C 7: 28,759,203 D327G possibly damaging Het
Notch1 C T 2: 26,476,375 V776I probably benign Het
Obsl1 G T 1: 75,489,517 D1522E probably damaging Het
Olfr1464-ps1 A T 19: 13,282,153 F302I unknown Het
Olfr605 T A 7: 103,442,788 M112L probably benign Het
Olfr823 T C 10: 130,112,224 K189E probably benign Het
Olfr859 T C 9: 19,808,648 M110T possibly damaging Het
Pde7a T C 3: 19,227,674 N471D probably benign Het
Pla2r1 T C 2: 60,530,435 H203R probably benign Het
Plch2 C A 4: 154,998,472 C573F probably damaging Het
Polr1a G A 6: 71,941,456 R666Q probably benign Het
Prepl T C 17: 85,081,240 N145S probably benign Het
Psen2 C T 1: 180,238,956 V139M probably benign Het
Ptgdr A T 14: 44,859,192 M21K possibly damaging Het
Rapgef6 T C 11: 54,691,239 W1331R probably benign Het
Rp1l1 G A 14: 64,032,298 G1778S probably benign Het
Rrbp1 A T 2: 143,969,462 M824K probably benign Het
Sel1l T C 12: 91,848,965 T23A probably benign Het
Sele A G 1: 164,053,868 S515G possibly damaging Het
Slc35f3 T G 8: 126,394,558 L386R probably benign Het
Stab2 G A 10: 86,946,220 S699L probably damaging Het
Synrg A T 11: 84,009,381 L726F probably damaging Het
Syt3 G A 7: 44,395,919 V528M probably damaging Het
Szt2 A G 4: 118,391,249 I655T probably damaging Het
Tbr1 T C 2: 61,812,256 S622P probably damaging Het
Tex36 C T 7: 133,587,223 G207S probably benign Het
Trav5n-4 G A 14: 53,312,942 W13* probably null Het
Trdn A T 10: 33,437,736 E500V probably null Het
Ugt2b38 A T 5: 87,411,895 N379K probably damaging Het
Unc13d T C 11: 116,074,050 R248G possibly damaging Het
Vmn1r195 C T 13: 22,278,749 L130F probably damaging Het
Vmn2r110 T C 17: 20,574,209 I733V probably benign Het
Zfp870 T A 17: 32,883,854 N167I probably damaging Het
Zmynd10 A T 9: 107,549,304 M179L probably benign Het
Other mutations in Slc22a23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Slc22a23 APN 13 34305245 missense probably damaging 1.00
IGL01762:Slc22a23 APN 13 34204001 missense possibly damaging 0.71
IGL02496:Slc22a23 APN 13 34344485 missense possibly damaging 0.93
IGL02516:Slc22a23 APN 13 34203955 missense probably benign 0.02
IGL02831:Slc22a23 APN 13 34299069 missense possibly damaging 0.81
Foreshadowed UTSW 13 34195479 missense probably damaging 0.98
foretold UTSW 13 34305180 missense probably benign 0.08
R0234:Slc22a23 UTSW 13 34183261 missense probably damaging 1.00
R0234:Slc22a23 UTSW 13 34183261 missense probably damaging 1.00
R0413:Slc22a23 UTSW 13 34183132 missense probably damaging 1.00
R0557:Slc22a23 UTSW 13 34344383 missense possibly damaging 0.50
R0558:Slc22a23 UTSW 13 34344383 missense possibly damaging 0.50
R0636:Slc22a23 UTSW 13 34299093 missense probably benign 0.01
R0676:Slc22a23 UTSW 13 34195479 missense probably damaging 0.98
R0739:Slc22a23 UTSW 13 34344383 missense possibly damaging 0.50
R0990:Slc22a23 UTSW 13 34195467 missense probably damaging 1.00
R1515:Slc22a23 UTSW 13 34203964 missense probably benign 0.33
R2128:Slc22a23 UTSW 13 34203970 missense possibly damaging 0.76
R2147:Slc22a23 UTSW 13 34183007 missense probably benign 0.00
R3113:Slc22a23 UTSW 13 34183075 missense probably damaging 0.98
R3780:Slc22a23 UTSW 13 34344340 missense probably benign 0.14
R3945:Slc22a23 UTSW 13 34183126 missense probably damaging 0.98
R3946:Slc22a23 UTSW 13 34183126 missense probably damaging 0.98
R4056:Slc22a23 UTSW 13 34299004 nonsense probably null
R4095:Slc22a23 UTSW 13 34305206 missense probably damaging 1.00
R4854:Slc22a23 UTSW 13 34203941 missense probably benign
R5594:Slc22a23 UTSW 13 34305257 missense probably damaging 0.99
R5611:Slc22a23 UTSW 13 34305239 missense probably benign 0.00
R6167:Slc22a23 UTSW 13 34344559 missense probably damaging 0.97
R6927:Slc22a23 UTSW 13 34344379 missense probably benign 0.07
R6933:Slc22a23 UTSW 13 34305180 missense probably benign 0.08
R6960:Slc22a23 UTSW 13 34344157 critical splice donor site probably null
R7313:Slc22a23 UTSW 13 34183178 missense probably damaging 1.00
X0064:Slc22a23 UTSW 13 34344466 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGTCCTGTCATCCTTCAAACATCC -3'
(R):5'- TACACTTCCATGCAGAACGC -3'

Sequencing Primer
(F):5'- TTCAAACATCCCCAGACATACTTCTG -3'
(R):5'- TGCAGAACGCCCAGACTCTTC -3'
Posted On2019-06-26