Incidental Mutation 'R0635:Haao'
ID56644
Institutional Source Beutler Lab
Gene Symbol Haao
Ensembl Gene ENSMUSG00000000673
Gene Name3-hydroxyanthranilate 3,4-dioxygenase
Synonyms3HAO, 0610012J07Rik, 0610007K21Rik, 3-HAO, 3-HAOxase
MMRRC Submission 038824-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0635 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location83831356-83846790 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 83838574 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 83 (F83S)
Ref Sequence ENSEMBL: ENSMUSP00000000687 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000687]
Predicted Effect probably damaging
Transcript: ENSMUST00000000687
AA Change: F83S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000000687
Gene: ENSMUSG00000000673
AA Change: F83S

DomainStartEndE-ValueType
Pfam:3-HAO 1 149 1e-78 PFAM
Meta Mutation Damage Score 0.9397 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.9%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] 3-Hydroxyanthranilate 3,4-dioxygenase is a monomeric cytosolic protein belonging to the family of intramolecular dioxygenases containing nonheme ferrous iron. It is widely distributed in peripheral organs, such as liver and kidney, and is also present in low amounts in the central nervous system. HAAO catalyzes the synthesis of quinolinic acid (QUIN) from 3-hydroxyanthranilic acid. QUIN is an excitotoxin whose toxicity is mediated by its ability to activate glutamate N-methyl-D-aspartate receptors. Increased cerebral levels of QUIN may participate in the pathogenesis of neurologic and inflammatory disorders. HAAO has been suggested to play a role in disorders associated with altered tissue levels of QUIN. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced LPS-induced depressive behaviors and altered kynurenine metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik A G 14: 49,773,143 L369S probably benign Het
4932429P05Rik T C X: 89,752,522 probably benign Het
5730455P16Rik A T 11: 80,374,065 probably benign Het
Adamts15 A G 9: 30,904,770 L631P probably damaging Het
Adamts17 T C 7: 66,908,605 F266L probably damaging Het
Adgrb1 C A 15: 74,540,892 Q488K possibly damaging Het
Cep290 A G 10: 100,492,676 D109G probably damaging Het
Chil5 A T 3: 106,017,203 Y229N possibly damaging Het
Cntnap1 A G 11: 101,183,459 T742A probably benign Het
Col6a3 A T 1: 90,808,086 probably null Het
Col6a5 G A 9: 105,928,606 P1034S unknown Het
Daxx T A 17: 33,912,644 D442E probably benign Het
Dmxl1 T C 18: 49,851,423 probably benign Het
Dnah11 A G 12: 118,007,996 F2942S probably damaging Het
Fam71a T C 1: 191,163,727 T240A probably benign Het
Glg1 A G 8: 111,163,764 probably benign Het
Gm10272 G A 10: 77,706,701 probably benign Het
Gm17333 AAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAA AAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAA 16: 77,852,878 noncoding transcript Het
Hdgfl2 T A 17: 56,096,057 L177Q probably damaging Het
Hrh1 T C 6: 114,480,145 V129A probably damaging Het
Ift43 T A 12: 86,085,081 probably benign Het
Il21r T C 7: 125,632,506 Y369H probably damaging Het
Il2ra C T 2: 11,680,366 T171M probably benign Het
Lao1 C T 4: 118,968,296 R438C probably benign Het
Lrrcc1 G A 3: 14,559,228 S350N probably benign Het
Mageb5 T A X: 91,779,993 Y260F probably benign Het
March5 A T 19: 37,220,408 I159F possibly damaging Het
Mgat4a G A 1: 37,452,294 A282V probably benign Het
Mipep G A 14: 60,829,390 V420I probably damaging Het
Morc2b A T 17: 33,137,687 F370L possibly damaging Het
Mt1 A T 8: 94,179,821 probably null Het
Ncapd2 A G 6: 125,173,036 V943A probably benign Het
Nkd2 T C 13: 73,826,894 D58G probably benign Het
Nol8 C G 13: 49,676,758 S1106C probably benign Het
Nrm C A 17: 35,864,264 Y61* probably null Het
Nusap1 A G 2: 119,627,667 T95A probably damaging Het
Ocln T A 13: 100,506,236 Q197L probably damaging Het
Olfr495 T A 7: 108,395,764 F215I probably benign Het
Oxtr A G 6: 112,489,200 Y200H probably damaging Het
Paip2b T C 6: 83,809,909 E115G possibly damaging Het
Pcm1 T A 8: 41,267,179 probably benign Het
Pcnt T C 10: 76,404,585 D1205G probably damaging Het
Phka1 G A X: 102,621,400 R186C probably damaging Het
Pik3cb A G 9: 99,064,218 probably benign Het
Pik3r1 C T 13: 101,757,418 R81K probably benign Het
Ppa1 A G 10: 61,665,440 D162G probably benign Het
Ppa1 A G 10: 61,666,970 R191G probably damaging Het
Prss22 T A 17: 23,996,688 T87S probably benign Het
Rgr T A 14: 37,038,947 R218* probably null Het
Rreb1 A T 13: 37,941,564 Q1282L possibly damaging Het
Scel T A 14: 103,583,139 probably null Het
Sema6b A G 17: 56,129,971 probably null Het
Slc4a1 T C 11: 102,352,672 E711G possibly damaging Het
Snx19 C A 9: 30,428,810 L415M probably damaging Het
Snx19 T G 9: 30,428,811 L415R probably damaging Het
Specc1 G A 11: 62,118,903 R495Q probably damaging Het
Tead1 T C 7: 112,891,706 probably benign Het
Timm10b A C 7: 105,640,688 probably benign Het
Ubxn7 T A 16: 32,367,417 probably benign Het
Vmn2r116 T A 17: 23,386,887 Y258N possibly damaging Het
Vmn2r77 T A 7: 86,811,175 F570I probably benign Het
Vmn2r98 T C 17: 19,080,497 V587A probably benign Het
Zfp398 T C 6: 47,863,140 I101T probably damaging Het
Zfp808 T A 13: 62,172,419 H487Q probably damaging Het
Other mutations in Haao
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Haao APN 17 83834930 splice site probably benign
IGL01728:Haao APN 17 83835229 missense probably damaging 1.00
IGL02603:Haao APN 17 83835541 missense probably benign 0.45
IGL03328:Haao APN 17 83846649 missense probably damaging 1.00
R1295:Haao UTSW 17 83838838 missense probably benign 0.38
R1296:Haao UTSW 17 83838838 missense probably benign 0.38
R1472:Haao UTSW 17 83838838 missense probably benign 0.38
R1563:Haao UTSW 17 83834889 missense probably benign 0.01
R2424:Haao UTSW 17 83835562 missense probably damaging 0.99
R3917:Haao UTSW 17 83838799 critical splice donor site probably null
R4657:Haao UTSW 17 83832345 missense possibly damaging 0.67
R4857:Haao UTSW 17 83838580 critical splice acceptor site probably null
R6475:Haao UTSW 17 83831684 missense possibly damaging 0.87
R6989:Haao UTSW 17 83831674 missense probably damaging 1.00
R7390:Haao UTSW 17 83846652 missense probably damaging 0.99
R8073:Haao UTSW 17 83835220 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- CGCAGTATTTGCCCATACCAGGAC -3'
(R):5'- TGAGGCTGACCCCAAAGAAAGC -3'

Sequencing Primer
(F):5'- CCATACCAGGACATGTGGC -3'
(R):5'- GTGGCCGAGCAGAAACC -3'
Posted On2013-07-11