Mutagenetix > Incidental Mutation

Incidental Mutation 'R7291:Rp1l1'

566442

Institutional Source

Beutler Lab

Gene Symbol

Rp1l1

Ensembl Gene

ENSMUSG00000046049

Gene Name

retinitis pigmentosa 1 homolog like 1

Synonyms

Dcdc4, Rp1hl1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.071) question?

Stock #

R7291 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

63992506-64035025 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 64032298 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Serine at position 1778 (G1778S)

Ref Sequence

ENSEMBL: ENSMUSP00000055449 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000058229]

AlphaFold

Q8CGM2

Predicted Effect

probably benign
Transcript: ENSMUST00000058229
AA Change: G1778S

PolyPhen 2 Score 0.096 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000055449
Gene: ENSMUSG00000046049
AA Change: G1778S

Domain	Start	End	E-Value	Type
low complexity region	11	21	N/A	INTRINSIC
DCX	37	121	1.58e-13	SMART
DCX	155	239	1e-15	SMART
low complexity region	709	728	N/A	INTRINSIC
low complexity region	870	884	N/A	INTRINSIC
low complexity region	1159	1177	N/A	INTRINSIC
low complexity region	1228	1239	N/A	INTRINSIC
low complexity region	1612	1618	N/A	INTRINSIC
low complexity region	1642	1652	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the doublecortin family. This protein is a retinal-specific protein. It contains two N-terminal doublecortin domains, which can assemble and stabilize axonemal microtubules, but lacks the C-terminal repetitive regions including the 16aa repeat found in human RP1L1. This protein and the RP1 protein, another retinal-specific protein, play essential and synergistic roles in affecting photosensitivity and outer segment morphogenesis of rod photoreceptors. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit retinal photoreceptor abnormalities, including scattered outer segment disorganization, reduced electroretinogram amplitudes, and progressive retinal rod cell degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9430069I07Rik	T	C	15: 34,355,553	E51G	possibly damaging	Het
9530053A07Rik	A	C	7: 28,140,220	D486A	probably benign	Het
Abca14	C	A	7: 120,289,609	C1259*	probably null	Het
Ablim1	T	C	19: 57,215,908	E17G	probably benign	Het
Acsf3	G	A	8: 122,813,577	V505I	probably benign	Het
Actn1	T	C	12: 80,174,085	M650V	probably benign	Het
Adamts4	G	A	1: 171,256,528	V525I	probably benign	Het
Adh1	T	C	3: 138,282,808	Y181H	probably damaging	Het
Alpl	G	A	4: 137,752,698	R168W	probably damaging	Het
Ate1	T	G	7: 130,519,931	K11Q	probably benign	Het
Atpaf1	T	A	4: 115,811,091	F314L	probably damaging	Het
Baiap3	T	A	17: 25,244,317	D1004V	probably damaging	Het
Bpifb9a	C	T	2: 154,267,696	T504M	probably damaging	Het
C1s2	T	A	6: 124,625,384	I623F	probably benign	Het
Card11	T	C	5: 140,901,070	D308G	probably damaging	Het
Cul9	C	T	17: 46,540,433	V354I	probably benign	Het
Dnah1	A	T	14: 31,298,705	F1236I	probably damaging	Het
Dync2h1	T	A	9: 6,929,590	I4266F	possibly damaging	Het
Ear10	A	T	14: 43,922,920	V150D	probably damaging	Het
Elfn2	C	T	15: 78,672,983	A455T	probably benign	Het
Erp44	A	G	4: 48,208,792	Y223H	probably damaging	Het
Fam110b	T	A	4: 5,798,895	H104Q	probably benign	Het
Fcgbp	A	G	7: 28,101,392	N1288D	probably benign	Het
Fcrl1	T	C	3: 87,385,781		probably null	Het
Fmo2	G	T	1: 162,887,702	P117Q	probably benign	Het
Fsip2	A	G	2: 82,980,519	K2394R	possibly damaging	Het
Gab1	T	G	8: 80,800,151	K106T	probably damaging	Het
Gatad2b	T	C	3: 90,351,414	V248A	probably damaging	Het
Gemin6	T	C	17: 80,227,775	S55P	possibly damaging	Het
Gfm2	G	A	13: 97,175,024	V701I	probably benign	Het
Gm3250	T	C	10: 77,782,227	T106A	unknown	Het
Gm7356	T	C	17: 14,001,581	N62S	probably benign	Het
Gsdmc4	T	C	15: 63,902,840	T31A	possibly damaging	Het
H2-M10.1	T	A	17: 36,325,729	D61V	probably damaging	Het
Heatr5a	A	G	12: 51,925,339	L716S	probably damaging	Het
Hecw2	A	G	1: 53,914,594	Y831H	probably damaging	Het
Ifi202b	C	T	1: 173,974,815	S151N	probably benign	Het
Il15ra	C	T	2: 11,718,381	T72I	probably damaging	Het
Ints1	A	G	5: 139,765,074	L858P	probably damaging	Het
Kat2a	C	T	11: 100,710,900	V230I	possibly damaging	Het
Kcnq2	A	T	2: 181,088,379	I498N	possibly damaging	Het
Kif26b	C	T	1: 178,679,046	T229I	possibly damaging	Het
Ly75	T	A	2: 60,329,993	I957F	probably damaging	Het
Map3k12	T	A	15: 102,502,166	R459W	probably damaging	Het
Mia2	T	A	12: 59,158,369		probably null	Het
Mrgprf	A	G	7: 145,307,469	I53V	unknown	Het
Mttp	A	G	3: 138,091,203	L846P	probably damaging	Het
Myrip	C	T	9: 120,417,141	L112F	probably damaging	Het
Nav1	A	G	1: 135,465,859	F1047S	probably damaging	Het
Nfkbib	T	C	7: 28,759,203	D327G	possibly damaging	Het
Notch1	C	T	2: 26,476,375	V776I	probably benign	Het
Obsl1	G	T	1: 75,489,517	D1522E	probably damaging	Het
Olfr1464-ps1	A	T	19: 13,282,153	F302I	unknown	Het
Olfr605	T	A	7: 103,442,788	M112L	probably benign	Het
Olfr823	T	C	10: 130,112,224	K189E	probably benign	Het
Olfr859	T	C	9: 19,808,648	M110T	possibly damaging	Het
Pde7a	T	C	3: 19,227,674	N471D	probably benign	Het
Pla2r1	T	C	2: 60,530,435	H203R	probably benign	Het
Plch2	C	A	4: 154,998,472	C573F	probably damaging	Het
Polr1a	G	A	6: 71,941,456	R666Q	probably benign	Het
Prepl	T	C	17: 85,081,240	N145S	probably benign	Het
Psen2	C	T	1: 180,238,956	V139M	probably benign	Het
Ptgdr	A	T	14: 44,859,192	M21K	possibly damaging	Het
Rapgef6	T	C	11: 54,691,239	W1331R	probably benign	Het
Rrbp1	A	T	2: 143,969,462	M824K	probably benign	Het
Sel1l	T	C	12: 91,848,965	T23A	probably benign	Het
Sele	A	G	1: 164,053,868	S515G	possibly damaging	Het
Slc22a23	T	C	13: 34,197,839	N421D	probably damaging	Het
Slc35f3	T	G	8: 126,394,558	L386R	probably benign	Het
Stab2	G	A	10: 86,946,220	S699L	probably damaging	Het
Synrg	A	T	11: 84,009,381	L726F	probably damaging	Het
Syt3	G	A	7: 44,395,919	V528M	probably damaging	Het
Szt2	A	G	4: 118,391,249	I655T	probably damaging	Het
Tbr1	T	C	2: 61,812,256	S622P	probably damaging	Het
Tex36	C	T	7: 133,587,223	G207S	probably benign	Het
Trav5n-4	G	A	14: 53,312,942	W13*	probably null	Het
Trdn	A	T	10: 33,437,736	E500V	probably null	Het
Ugt2b38	A	T	5: 87,411,895	N379K	probably damaging	Het
Unc13d	T	C	11: 116,074,050	R248G	possibly damaging	Het
Vmn1r195	C	T	13: 22,278,749	L130F	probably damaging	Het
Vmn2r110	T	C	17: 20,574,209	I733V	probably benign	Het
Zfp870	T	A	17: 32,883,854	N167I	probably damaging	Het
Zmynd10	A	T	9: 107,549,304	M179L	probably benign	Het

Other mutations in Rp1l1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00494:Rp1l1	APN	14	64028725	missense	probably benign	0.01
IGL02063:Rp1l1	APN	14	64029536	missense	probably damaging	0.99
IGL02132:Rp1l1	APN	14	64028810	missense	probably benign
IGL02430:Rp1l1	APN	14	64029286	missense	probably benign	0.00
IGL02977:Rp1l1	APN	14	64028150	missense	probably benign	0.01
IGL03213:Rp1l1	APN	14	64028415	missense	probably damaging	0.98
IGL03346:Rp1l1	APN	14	64029440	missense	probably benign
R0085:Rp1l1	UTSW	14	64022295	missense	probably damaging	0.99
R0347:Rp1l1	UTSW	14	64030804	nonsense	probably null
R0362:Rp1l1	UTSW	14	64031066	nonsense	probably null
R0369:Rp1l1	UTSW	14	64029388	missense	possibly damaging	0.84
R0538:Rp1l1	UTSW	14	64022092	missense	probably damaging	1.00
R0544:Rp1l1	UTSW	14	64032066	missense	probably benign	0.00
R0780:Rp1l1	UTSW	14	64030351	missense	possibly damaging	0.94
R0944:Rp1l1	UTSW	14	64032232	missense	probably benign	0.05
R1051:Rp1l1	UTSW	14	64032535	missense	probably damaging	0.99
R1126:Rp1l1	UTSW	14	64030469	missense	probably damaging	1.00
R1450:Rp1l1	UTSW	14	64028150	missense	probably benign	0.01
R1483:Rp1l1	UTSW	14	64029047	missense	possibly damaging	0.76
R1508:Rp1l1	UTSW	14	64030892	missense	possibly damaging	0.83
R1553:Rp1l1	UTSW	14	64031894	missense	probably benign	0.00
R1651:Rp1l1	UTSW	14	64030993	missense	probably damaging	0.97
R1682:Rp1l1	UTSW	14	64028968	missense	probably damaging	0.98
R1809:Rp1l1	UTSW	14	64027966	missense	probably benign	0.18
R1885:Rp1l1	UTSW	14	64028390	missense	probably benign	0.01
R1887:Rp1l1	UTSW	14	64028390	missense	probably benign	0.01
R1898:Rp1l1	UTSW	14	64031590	missense	probably benign	0.04
R1924:Rp1l1	UTSW	14	64031543	missense	probably benign
R1939:Rp1l1	UTSW	14	64029593	missense	probably benign
R1941:Rp1l1	UTSW	14	64022252	missense	probably damaging	1.00
R2129:Rp1l1	UTSW	14	64028966	missense	possibly damaging	0.93
R2363:Rp1l1	UTSW	14	64029998	missense	possibly damaging	0.55
R3894:Rp1l1	UTSW	14	64029307	missense	probably benign
R3974:Rp1l1	UTSW	14	64030309	missense	probably damaging	1.00
R3975:Rp1l1	UTSW	14	64030309	missense	probably damaging	1.00
R3976:Rp1l1	UTSW	14	64030309	missense	probably damaging	1.00
R4072:Rp1l1	UTSW	14	64028132	missense	probably damaging	1.00
R4672:Rp1l1	UTSW	14	64031270	missense	probably damaging	1.00
R4673:Rp1l1	UTSW	14	64031270	missense	probably damaging	1.00
R4749:Rp1l1	UTSW	14	64029800	missense	probably damaging	0.99
R4755:Rp1l1	UTSW	14	64030070	missense	probably benign	0.34
R4877:Rp1l1	UTSW	14	64026171	missense	probably benign	0.00
R4930:Rp1l1	UTSW	14	64032206	missense	probably benign
R5039:Rp1l1	UTSW	14	64031356	missense	probably benign	0.21
R5106:Rp1l1	UTSW	14	64027946	missense	probably damaging	1.00
R5184:Rp1l1	UTSW	14	64030180	missense	probably damaging	1.00
R5215:Rp1l1	UTSW	14	64030013	missense	probably benign	0.01
R5409:Rp1l1	UTSW	14	64030621	missense	probably benign	0.02
R5575:Rp1l1	UTSW	14	64030984	missense	probably benign	0.23
R5696:Rp1l1	UTSW	14	64029746	missense	probably damaging	0.99
R5739:Rp1l1	UTSW	14	64032170	missense	probably benign	0.01
R5878:Rp1l1	UTSW	14	64028906	missense	probably benign	0.09
R6133:Rp1l1	UTSW	14	64030096	missense	probably damaging	1.00
R6134:Rp1l1	UTSW	14	64030096	missense	probably damaging	1.00
R6135:Rp1l1	UTSW	14	64030096	missense	probably damaging	1.00
R6428:Rp1l1	UTSW	14	64032389	missense	possibly damaging	0.92
R6594:Rp1l1	UTSW	14	64031677	nonsense	probably null
R6736:Rp1l1	UTSW	14	64029724	missense	possibly damaging	0.93
R6800:Rp1l1	UTSW	14	64031150	missense	possibly damaging	0.92
R6848:Rp1l1	UTSW	14	64028218	missense	possibly damaging	0.79
R6878:Rp1l1	UTSW	14	64031852	missense	probably benign	0.00
R6922:Rp1l1	UTSW	14	64030385	missense	possibly damaging	0.93
R6980:Rp1l1	UTSW	14	64028720	missense	probably benign	0.02
R7053:Rp1l1	UTSW	14	64031509	missense	possibly damaging	0.68
R7151:Rp1l1	UTSW	14	64029026	missense	possibly damaging	0.73
R7335:Rp1l1	UTSW	14	64031998	missense	probably benign	0.00
R7344:Rp1l1	UTSW	14	64029620	missense	probably benign	0.00
R7470:Rp1l1	UTSW	14	64028566	missense	probably benign
R7570:Rp1l1	UTSW	14	64031574	nonsense	probably null
R7585:Rp1l1	UTSW	14	64030139	missense	probably damaging	0.96
R7591:Rp1l1	UTSW	14	64026109	missense	probably damaging	1.00
R7667:Rp1l1	UTSW	14	64029803	missense	probably benign	0.04
R7862:Rp1l1	UTSW	14	64028027	missense	probably damaging	1.00
R7935:Rp1l1	UTSW	14	64031225	missense	probably damaging	0.99
R8256:Rp1l1	UTSW	14	64028153	missense	probably benign	0.18
R8403:Rp1l1	UTSW	14	64028809	missense	probably benign	0.21
R8709:Rp1l1	UTSW	14	64031846	missense	probably damaging	0.98
R8817:Rp1l1	UTSW	14	64030636	missense	probably benign
R8971:Rp1l1	UTSW	14	64021996	missense	probably damaging	1.00
R9380:Rp1l1	UTSW	14	64029026	missense	probably benign	0.29
R9438:Rp1l1	UTSW	14	64028125	missense	possibly damaging	0.90
R9501:Rp1l1	UTSW	14	64028590	missense	probably benign	0.00
R9652:Rp1l1	UTSW	14	64032265	missense	probably damaging	1.00
R9683:Rp1l1	UTSW	14	64031677	missense	probably damaging	0.97
X0057:Rp1l1	UTSW	14	64030040	missense	probably benign	0.14
X0063:Rp1l1	UTSW	14	64029223	missense	probably damaging	0.98
Z1088:Rp1l1	UTSW	14	64028758	missense	possibly damaging	0.80
Z1088:Rp1l1	UTSW	14	64030378	missense	probably benign	0.01
Z1176:Rp1l1	UTSW	14	64029144	missense	probably damaging	1.00
Z1177:Rp1l1	UTSW	14	64032297	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AAGACAGTCCTTGGGTGAGCTC -3'
(R):5'- GCCAAAGCCATCTACCTTGC -3'

Sequencing Primer
(F):5'- CCTTGGGTGAGCTCAGGAGAG -3'
(R):5'- TGGGTACAAGCCAAGCTTC -3'

Posted On

2019-06-26