Incidental Mutation 'R7292:Adgrb3'
ID566458
Institutional Source Beutler Lab
Gene Symbol Adgrb3
Ensembl Gene ENSMUSG00000033569
Gene Nameadhesion G protein-coupled receptor B3
SynonymsBai3, A830096D10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.461) question?
Stock #R7292 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location25067476-25829707 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25531876 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 507 (C507R)
Ref Sequence ENSEMBL: ENSMUSP00000035612 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041838] [ENSMUST00000135518] [ENSMUST00000146592] [ENSMUST00000151309]
Predicted Effect probably damaging
Transcript: ENSMUST00000041838
AA Change: C507R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035612
Gene: ENSMUSG00000033569
AA Change: C507R

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
TSP1 294 343 2.1e-12 SMART
TSP1 348 398 7.97e-13 SMART
TSP1 403 453 6.28e-11 SMART
TSP1 458 508 1.48e-7 SMART
HormR 510 576 4.15e-20 SMART
Pfam:DUF3497 586 810 1.7e-52 PFAM
GPS 815 868 1.24e-21 SMART
Pfam:7tm_2 874 1143 2.1e-64 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000135518
AA Change: C507R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119804
Gene: ENSMUSG00000033569
AA Change: C507R

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
TSP1 294 343 2.1e-12 SMART
TSP1 348 398 7.97e-13 SMART
TSP1 403 453 6.28e-11 SMART
TSP1 458 508 1.48e-7 SMART
HormR 510 576 4.15e-20 SMART
Pfam:DUF3497 586 810 1.7e-52 PFAM
GPS 815 868 1.24e-21 SMART
Pfam:7tm_2 874 1143 2.1e-64 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000146592
AA Change: C300R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116759
Gene: ENSMUSG00000033569
AA Change: C300R

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
TSP1 87 136 2.1e-12 SMART
TSP1 141 191 7.97e-13 SMART
TSP1 196 246 6.28e-11 SMART
TSP1 251 301 1.48e-7 SMART
HormR 303 369 4.15e-20 SMART
Pfam:DUF3497 379 603 2.5e-52 PFAM
GPS 608 661 1.24e-21 SMART
Pfam:7tm_2 667 903 5.4e-66 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000151309
AA Change: C507R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116231
Gene: ENSMUSG00000033569
AA Change: C507R

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
TSP1 294 343 2.1e-12 SMART
TSP1 348 398 7.97e-13 SMART
TSP1 403 453 6.28e-11 SMART
TSP1 458 508 1.48e-7 SMART
HormR 510 576 4.15e-20 SMART
Pfam:GAIN 589 794 1.1e-44 PFAM
GPS 815 868 1.24e-21 SMART
Pfam:7tm_2 875 1143 2.7e-63 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This p53-target gene encodes a brain-specific angiogenesis inhibitor, a seven-span transmembrane protein, and is thought to be a member of the secretin receptor family. Brain-specific angiogenesis proteins BAI2 and BAI3 are similar to BAI1 in structure, have similar tissue specificities, and may also play a role in angiogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a conditional allele activated in Purkinje cells exhibit impaired motor learning with alterned climbing fiber electrophysiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,466,110 probably benign Het
1700010I14Rik T A 17: 8,997,029 C322* probably null Het
1700019N19Rik A T 19: 58,789,107 Y90* probably null Het
2310035C23Rik G T 1: 105,721,416 probably null Het
4930553M12Rik G A 4: 88,868,331 R17C unknown Het
Abcc8 G A 7: 46,135,526 T726I probably benign Het
Adamts18 T C 8: 113,709,645 T981A probably benign Het
Bloc1s6 T A 2: 122,742,695 D63E probably damaging Het
Cdc25b C T 2: 131,191,173 R135W probably damaging Het
Cdca2 G T 14: 67,677,877 Y644* probably null Het
Ceacam10 G T 7: 24,778,350 G97C probably damaging Het
Cenpf G A 1: 189,650,694 L2668F probably damaging Het
Cog4 A G 8: 110,881,828 D774G probably damaging Het
Col11a2 G A 17: 34,051,508 G511E unknown Het
Col19a1 T A 1: 24,530,008 I220F unknown Het
Cubn G T 2: 13,424,739 T1317K probably damaging Het
Dnaaf5 T C 5: 139,150,317 L24P unknown Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Foxn4 C A 5: 114,258,655 E256* probably null Het
Gm4869 A G 5: 140,471,670 D398G probably benign Het
Gm5580 G A 6: 116,551,477 R105Q probably damaging Het
Gm5930 A G 14: 44,336,557 S108P probably damaging Het
Gnl3 A G 14: 31,013,232 S468P probably benign Het
Gzmb A T 14: 56,262,119 S11T probably benign Het
Hmcn1 T C 1: 150,733,129 probably null Het
Ifi206 A G 1: 173,473,862 L750P unknown Het
Ifi213 T A 1: 173,595,125 E58V probably damaging Het
Igkv4-78 A T 6: 69,059,768 Y94N probably damaging Het
Igsf9 G T 1: 172,491,757 probably null Het
Itpr2 G T 6: 146,158,949 L2490M possibly damaging Het
Kdm2b A G 5: 122,880,791 F862S probably damaging Het
Meis1 A G 11: 19,011,351 I174T probably damaging Het
Micu3 A G 8: 40,382,125 Q507R probably benign Het
Mpp4 C T 1: 59,143,810 E313K possibly damaging Het
Nfatc4 G A 14: 55,825,055 E7K probably damaging Het
Olfr466 T A 13: 65,152,842 V206D possibly damaging Het
Olfr828 A T 9: 18,816,190 Y35N probably damaging Het
Osbpl5 G A 7: 143,701,278 P470S probably damaging Het
Pak6 A G 2: 118,693,591 D409G possibly damaging Het
Pkhd1l1 T A 15: 44,498,590 M553K probably benign Het
Ppp2r3a T C 9: 101,212,672 N151D probably damaging Het
Prdm12 T C 2: 31,643,850 W160R probably damaging Het
Prdm2 G A 4: 143,132,901 T1273M possibly damaging Het
Prl2a1 A G 13: 27,807,370 probably null Het
Prob1 G A 18: 35,654,550 P217L possibly damaging Het
Ramp1 A C 1: 91,196,777 H20P probably benign Het
Rbm47 T A 5: 66,026,750 E170V possibly damaging Het
Rpn1 C T 6: 88,090,084 P142L probably damaging Het
Rsu1 C T 2: 13,170,016 R238H probably damaging Het
Sh3rf3 C T 10: 59,071,973 P441L probably damaging Het
Slc1a6 A G 10: 78,814,604 S559G possibly damaging Het
Slc35f5 C A 1: 125,572,485 S245R probably damaging Het
Spcs3 T C 8: 54,526,519 N76D probably benign Het
Svep1 T C 4: 58,111,395 T1075A possibly damaging Het
Sympk A T 7: 19,036,030 I211F probably benign Het
Tk1 C T 11: 117,825,777 M1I probably null Het
Tln2 A G 9: 67,346,461 V776A probably benign Het
Tmem94 G T 11: 115,786,256 R118L possibly damaging Het
Tnk2 T C 16: 32,680,800 V977A probably benign Het
Toporsl A T 4: 52,611,630 S508C probably benign Het
Trank1 A C 9: 111,377,870 R1690S probably benign Het
Trio T A 15: 27,828,351 Q1409L possibly damaging Het
Vit T C 17: 78,605,498 F287L probably benign Het
Vmn2r109 G C 17: 20,541,438 D552E probably benign Het
Zw10 T C 9: 49,061,191 V186A probably benign Het
Other mutations in Adgrb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Adgrb3 APN 1 25228500 missense probably benign 0.09
IGL00507:Adgrb3 APN 1 25074715 missense possibly damaging 0.93
IGL00828:Adgrb3 APN 1 25488119 missense possibly damaging 0.73
IGL01285:Adgrb3 APN 1 25093787 missense probably benign 0.32
IGL01309:Adgrb3 APN 1 25112271 missense possibly damaging 0.69
IGL01540:Adgrb3 APN 1 25112171 splice site probably null
IGL01608:Adgrb3 APN 1 25553774 missense probably damaging 1.00
IGL01638:Adgrb3 APN 1 25559751 splice site probably benign
IGL01657:Adgrb3 APN 1 25826493 missense probably benign 0.03
IGL01666:Adgrb3 APN 1 25460751 missense probably damaging 0.96
IGL01712:Adgrb3 APN 1 25826279 missense probably benign
IGL01767:Adgrb3 APN 1 25559814 missense probably benign 0.00
IGL01987:Adgrb3 APN 1 25101431 critical splice donor site probably null
IGL02201:Adgrb3 APN 1 25420550 splice site probably benign
IGL02584:Adgrb3 APN 1 25504984 missense probably damaging 0.98
IGL02685:Adgrb3 APN 1 25084242 critical splice donor site probably null
IGL02886:Adgrb3 APN 1 25504910 splice site probably null
IGL02929:Adgrb3 APN 1 25553824 missense probably benign 0.00
IGL03153:Adgrb3 APN 1 25531897 nonsense probably null
IGL03165:Adgrb3 APN 1 25094394 missense probably benign 0.05
IGL03227:Adgrb3 APN 1 25547475 missense probably damaging 1.00
IGL03392:Adgrb3 APN 1 25504448 missense probably damaging 0.99
schwach UTSW 1 25111691 critical splice donor site probably null
R0007:Adgrb3 UTSW 1 25111691 critical splice donor site probably null
R0048:Adgrb3 UTSW 1 25101482 missense probably benign 0.02
R0048:Adgrb3 UTSW 1 25101482 missense probably benign 0.02
R0322:Adgrb3 UTSW 1 25221748 splice site probably benign
R0442:Adgrb3 UTSW 1 25396470 missense probably damaging 0.96
R0563:Adgrb3 UTSW 1 25547554 missense probably damaging 0.99
R1168:Adgrb3 UTSW 1 25826199 missense probably benign
R1252:Adgrb3 UTSW 1 25128828 missense probably damaging 1.00
R1264:Adgrb3 UTSW 1 25559850 missense probably damaging 0.97
R1543:Adgrb3 UTSW 1 25488088 missense probably benign 0.01
R1577:Adgrb3 UTSW 1 25094183 missense possibly damaging 0.51
R1581:Adgrb3 UTSW 1 25094072 missense possibly damaging 0.94
R1583:Adgrb3 UTSW 1 25226831 splice site probably null
R1653:Adgrb3 UTSW 1 25101503 missense probably benign 0.09
R1725:Adgrb3 UTSW 1 25826300 missense probably damaging 1.00
R1792:Adgrb3 UTSW 1 25228471 missense probably damaging 1.00
R1827:Adgrb3 UTSW 1 25532577 missense probably damaging 0.99
R1838:Adgrb3 UTSW 1 25084270 missense probably damaging 1.00
R1869:Adgrb3 UTSW 1 25826438 missense possibly damaging 0.83
R1971:Adgrb3 UTSW 1 25547444 missense probably benign 0.02
R2005:Adgrb3 UTSW 1 25111718 missense probably benign 0.25
R2134:Adgrb3 UTSW 1 25093957 missense probably damaging 0.99
R2142:Adgrb3 UTSW 1 25068209 missense probably damaging 1.00
R2268:Adgrb3 UTSW 1 25111817 missense possibly damaging 0.79
R3740:Adgrb3 UTSW 1 25826454 missense probably benign 0.00
R3877:Adgrb3 UTSW 1 25111825 missense probably damaging 1.00
R4120:Adgrb3 UTSW 1 25094307 nonsense probably null
R4344:Adgrb3 UTSW 1 25826748 missense possibly damaging 0.61
R4363:Adgrb3 UTSW 1 25112222 missense probably damaging 1.00
R4438:Adgrb3 UTSW 1 25831027 unclassified probably benign
R4465:Adgrb3 UTSW 1 25094366 missense probably damaging 1.00
R4480:Adgrb3 UTSW 1 25111748 missense probably damaging 1.00
R4554:Adgrb3 UTSW 1 25084279 missense probably damaging 1.00
R4557:Adgrb3 UTSW 1 25084279 missense probably damaging 1.00
R4622:Adgrb3 UTSW 1 25826488 missense probably damaging 0.99
R4713:Adgrb3 UTSW 1 25547532 missense probably damaging 1.00
R4772:Adgrb3 UTSW 1 25531875 missense probably damaging 1.00
R4890:Adgrb3 UTSW 1 25221827 missense probably damaging 1.00
R5045:Adgrb3 UTSW 1 25074779 missense probably damaging 1.00
R5061:Adgrb3 UTSW 1 25068128 utr 3 prime probably benign
R5097:Adgrb3 UTSW 1 25826084 missense probably damaging 1.00
R5227:Adgrb3 UTSW 1 25093952 missense possibly damaging 0.55
R5241:Adgrb3 UTSW 1 25111790 missense possibly damaging 0.85
R5328:Adgrb3 UTSW 1 25094275 missense possibly damaging 0.90
R5372:Adgrb3 UTSW 1 25128859 missense probably benign 0.01
R5703:Adgrb3 UTSW 1 25420559 missense probably damaging 1.00
R5747:Adgrb3 UTSW 1 25826562 missense probably damaging 1.00
R5998:Adgrb3 UTSW 1 25431501 splice site probably null
R6006:Adgrb3 UTSW 1 25826531 missense possibly damaging 0.85
R6077:Adgrb3 UTSW 1 25094000 nonsense probably null
R6183:Adgrb3 UTSW 1 25094370 missense probably damaging 0.98
R6190:Adgrb3 UTSW 1 25420647 missense probably benign 0.01
R6249:Adgrb3 UTSW 1 25432558 missense probably damaging 1.00
R6310:Adgrb3 UTSW 1 25111718 missense probably benign 0.13
R6450:Adgrb3 UTSW 1 25420602 missense probably benign
R6678:Adgrb3 UTSW 1 25460810 missense possibly damaging 0.84
R6679:Adgrb3 UTSW 1 25131296 missense probably benign 0.01
R6685:Adgrb3 UTSW 1 25111736 nonsense probably null
R6730:Adgrb3 UTSW 1 25094294 missense probably damaging 1.00
R6805:Adgrb3 UTSW 1 25826172 missense possibly damaging 0.83
R6847:Adgrb3 UTSW 1 25093922 missense probably benign 0.03
R6929:Adgrb3 UTSW 1 25111771 nonsense probably null
R6953:Adgrb3 UTSW 1 25826511 missense probably damaging 1.00
R7062:Adgrb3 UTSW 1 25826085 missense possibly damaging 0.90
R7244:Adgrb3 UTSW 1 25131269 missense probably damaging 1.00
R7325:Adgrb3 UTSW 1 25532630 missense probably benign 0.01
R7378:Adgrb3 UTSW 1 25531919 nonsense probably null
R7489:Adgrb3 UTSW 1 25547505 missense probably damaging 1.00
R7615:Adgrb3 UTSW 1 25098897 missense probably damaging 1.00
R7623:Adgrb3 UTSW 1 25547548 missense probably damaging 1.00
R7787:Adgrb3 UTSW 1 25432544 missense probably damaging 1.00
R7837:Adgrb3 UTSW 1 25128834 missense probably damaging 1.00
R8064:Adgrb3 UTSW 1 25420556 critical splice donor site probably null
R8152:Adgrb3 UTSW 1 25221757 splice site probably null
R8161:Adgrb3 UTSW 1 25093922 missense probably benign 0.03
R8225:Adgrb3 UTSW 1 25826516 missense probably benign 0.00
R8417:Adgrb3 UTSW 1 25488053 missense probably benign 0.21
R8694:Adgrb3 UTSW 1 25826391 missense probably damaging 0.98
R8742:Adgrb3 UTSW 1 25226754 missense probably benign 0.01
R8886:Adgrb3 UTSW 1 25111847 missense probably damaging 1.00
R8941:Adgrb3 UTSW 1 25094154 missense probably damaging 1.00
R8958:Adgrb3 UTSW 1 25826109 missense possibly damaging 0.68
Z1088:Adgrb3 UTSW 1 25131271 missense probably damaging 1.00
Z1176:Adgrb3 UTSW 1 25093914 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- GTAGCTACAATTGGGCTATCATG -3'
(R):5'- CTTTCTTTCAGCCAATGGTCAG -3'

Sequencing Primer
(F):5'- GCTACAATTGGGCTATCATGTATTTC -3'
(R):5'- TCAGTGGAATCAGTGGGGTCAC -3'
Posted On2019-06-26