Incidental Mutation 'R7292:Cdc25b'
ID566473
Institutional Source Beutler Lab
Gene Symbol Cdc25b
Ensembl Gene ENSMUSG00000027330
Gene Namecell division cycle 25B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7292 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location131186949-131198497 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 131191173 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 135 (R135W)
Ref Sequence ENSEMBL: ENSMUSP00000028804 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028801] [ENSMUST00000028804] [ENSMUST00000079857]
Predicted Effect probably benign
Transcript: ENSMUST00000028801
SMART Domains Protein: ENSMUSP00000028801
Gene: ENSMUSG00000027329

DomainStartEndE-ValueType
Pfam:CH_2 13 109 9.3e-36 PFAM
Pfam:CAMSAP_CH 14 96 7.9e-24 PFAM
coiled coil region 182 234 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000028804
AA Change: R135W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028804
Gene: ENSMUSG00000027330
AA Change: R135W

DomainStartEndE-ValueType
low complexity region 86 105 N/A INTRINSIC
Pfam:M-inducer_phosp 111 379 3.3e-103 PFAM
RHOD 417 531 4.29e-26 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000079857
AA Change: R135W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078784
Gene: ENSMUSG00000027330
AA Change: R135W

DomainStartEndE-ValueType
low complexity region 86 105 N/A INTRINSIC
Pfam:M-inducer_phosp 111 354 2.4e-78 PFAM
RHOD 391 505 4.29e-26 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CDC25B is a member of the CDC25 family of phosphatases. CDC25B activates the cyclin dependent kinase CDC2 by removing two phosphate groups and it is required for entry into mitosis. CDC25B shuttles between the nucleus and the cytoplasm due to nuclear localization and nuclear export signals. The protein is nuclear in the M and G1 phases of the cell cycle and moves to the cytoplasm during S and G2. CDC25B has oncogenic properties, although its role in tumor formation has not been determined. Multiple transcript variants for this gene exist. [provided by RefSeq, Jul 2008]
PHENOTYPE: The resumption of meiosis during oocyte maturation is blocked in homozygous mutant female mice, resulting in female infertility. Male mice do not show an overt reproductive phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,466,110 probably benign Het
1700010I14Rik T A 17: 8,997,029 C322* probably null Het
1700019N19Rik A T 19: 58,789,107 Y90* probably null Het
2310035C23Rik G T 1: 105,721,416 probably null Het
4930553M12Rik G A 4: 88,868,331 R17C unknown Het
Abcc8 G A 7: 46,135,526 T726I probably benign Het
Adamts18 T C 8: 113,709,645 T981A probably benign Het
Adgrb3 A G 1: 25,531,876 C507R probably damaging Het
Bloc1s6 T A 2: 122,742,695 D63E probably damaging Het
Cdca2 G T 14: 67,677,877 Y644* probably null Het
Ceacam10 G T 7: 24,778,350 G97C probably damaging Het
Cenpf G A 1: 189,650,694 L2668F probably damaging Het
Cog4 A G 8: 110,881,828 D774G probably damaging Het
Col11a2 G A 17: 34,051,508 G511E unknown Het
Col19a1 T A 1: 24,530,008 I220F unknown Het
Cubn G T 2: 13,424,739 T1317K probably damaging Het
Dnaaf5 T C 5: 139,150,317 L24P unknown Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Foxn4 C A 5: 114,258,655 E256* probably null Het
Gm4869 A G 5: 140,471,670 D398G probably benign Het
Gm5580 G A 6: 116,551,477 R105Q probably damaging Het
Gm5930 A G 14: 44,336,557 S108P probably damaging Het
Gnl3 A G 14: 31,013,232 S468P probably benign Het
Gzmb A T 14: 56,262,119 S11T probably benign Het
Hmcn1 T C 1: 150,733,129 probably null Het
Ifi206 A G 1: 173,473,862 L750P unknown Het
Ifi213 T A 1: 173,595,125 E58V probably damaging Het
Igkv4-78 A T 6: 69,059,768 Y94N probably damaging Het
Igsf9 G T 1: 172,491,757 probably null Het
Itpr2 G T 6: 146,158,949 L2490M possibly damaging Het
Kdm2b A G 5: 122,880,791 F862S probably damaging Het
Meis1 A G 11: 19,011,351 I174T probably damaging Het
Micu3 A G 8: 40,382,125 Q507R probably benign Het
Mpp4 C T 1: 59,143,810 E313K possibly damaging Het
Nfatc4 G A 14: 55,825,055 E7K probably damaging Het
Olfr466 T A 13: 65,152,842 V206D possibly damaging Het
Olfr828 A T 9: 18,816,190 Y35N probably damaging Het
Osbpl5 G A 7: 143,701,278 P470S probably damaging Het
Pak6 A G 2: 118,693,591 D409G possibly damaging Het
Pkhd1l1 T A 15: 44,498,590 M553K probably benign Het
Ppp2r3a T C 9: 101,212,672 N151D probably damaging Het
Prdm12 T C 2: 31,643,850 W160R probably damaging Het
Prdm2 G A 4: 143,132,901 T1273M possibly damaging Het
Prl2a1 A G 13: 27,807,370 probably null Het
Prob1 G A 18: 35,654,550 P217L possibly damaging Het
Ramp1 A C 1: 91,196,777 H20P probably benign Het
Rbm47 T A 5: 66,026,750 E170V possibly damaging Het
Rpn1 C T 6: 88,090,084 P142L probably damaging Het
Rsu1 C T 2: 13,170,016 R238H probably damaging Het
Sh3rf3 C T 10: 59,071,973 P441L probably damaging Het
Slc1a6 A G 10: 78,814,604 S559G possibly damaging Het
Slc35f5 C A 1: 125,572,485 S245R probably damaging Het
Spcs3 T C 8: 54,526,519 N76D probably benign Het
Svep1 T C 4: 58,111,395 T1075A possibly damaging Het
Sympk A T 7: 19,036,030 I211F probably benign Het
Tk1 C T 11: 117,825,777 M1I probably null Het
Tln2 A G 9: 67,346,461 V776A probably benign Het
Tmem94 G T 11: 115,786,256 R118L possibly damaging Het
Tnk2 T C 16: 32,680,800 V977A probably benign Het
Toporsl A T 4: 52,611,630 S508C probably benign Het
Trank1 A C 9: 111,377,870 R1690S probably benign Het
Trio T A 15: 27,828,351 Q1409L possibly damaging Het
Vit T C 17: 78,605,498 F287L probably benign Het
Vmn2r109 G C 17: 20,541,438 D552E probably benign Het
Zw10 T C 9: 49,061,191 V186A probably benign Het
Other mutations in Cdc25b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03230:Cdc25b APN 2 131188140 missense probably benign 0.00
R0471:Cdc25b UTSW 2 131197284 missense probably damaging 0.99
R0639:Cdc25b UTSW 2 131197262 missense probably benign 0.00
R0645:Cdc25b UTSW 2 131191613 missense probably benign 0.06
R0673:Cdc25b UTSW 2 131197262 missense probably benign 0.00
R1574:Cdc25b UTSW 2 131191137 splice site probably benign
R4094:Cdc25b UTSW 2 131189117 missense probably benign
R4433:Cdc25b UTSW 2 131191698 missense probably benign 0.02
R4722:Cdc25b UTSW 2 131193351 missense probably damaging 1.00
R4817:Cdc25b UTSW 2 131193303 missense probably damaging 1.00
R4957:Cdc25b UTSW 2 131193605 missense possibly damaging 0.80
R5345:Cdc25b UTSW 2 131192596 missense probably benign 0.18
R5407:Cdc25b UTSW 2 131193647 missense probably damaging 1.00
R5562:Cdc25b UTSW 2 131194758 missense probably damaging 1.00
R5594:Cdc25b UTSW 2 131191618 missense probably damaging 1.00
R5792:Cdc25b UTSW 2 131191759 missense probably damaging 1.00
R5831:Cdc25b UTSW 2 131187381 critical splice donor site probably null
R7204:Cdc25b UTSW 2 131191632 missense probably damaging 1.00
R7399:Cdc25b UTSW 2 131194654 missense probably damaging 1.00
R7501:Cdc25b UTSW 2 131194160 missense probably damaging 1.00
R7772:Cdc25b UTSW 2 131189109 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTTAAAATCCCAGGCTGCC -3'
(R):5'- AGCGTTTTATGGTAAACTGCTCAC -3'

Sequencing Primer
(F):5'- AACAGGGCGCCCTTTTC -3'
(R):5'- GCTCACTGCAAACAAACAAAC -3'
Posted On2019-06-26