Incidental Mutation 'R7292:4930553M12Rik'
ID566476
Institutional Source Beutler Lab
Gene Symbol 4930553M12Rik
Ensembl Gene ENSMUSG00000054351
Gene NameRIKEN cDNA 4930553M12 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R7292 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location88867882-88868379 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 88868331 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 17 (R17C)
Ref Sequence ENSEMBL: ENSMUSP00000052657 (fasta)
Predicted Effect unknown
Transcript: ENSMUST00000057837
AA Change: R17C
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (66/66)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,466,110 probably benign Het
1700010I14Rik T A 17: 8,997,029 C322* probably null Het
1700019N19Rik A T 19: 58,789,107 Y90* probably null Het
2310035C23Rik G T 1: 105,721,416 probably null Het
Abcc8 G A 7: 46,135,526 T726I probably benign Het
Adamts18 T C 8: 113,709,645 T981A probably benign Het
Adgrb3 A G 1: 25,531,876 C507R probably damaging Het
Bloc1s6 T A 2: 122,742,695 D63E probably damaging Het
Cdc25b C T 2: 131,191,173 R135W probably damaging Het
Cdca2 G T 14: 67,677,877 Y644* probably null Het
Ceacam10 G T 7: 24,778,350 G97C probably damaging Het
Cenpf G A 1: 189,650,694 L2668F probably damaging Het
Cog4 A G 8: 110,881,828 D774G probably damaging Het
Col11a2 G A 17: 34,051,508 G511E unknown Het
Col19a1 T A 1: 24,530,008 I220F unknown Het
Cubn G T 2: 13,424,739 T1317K probably damaging Het
Dnaaf5 T C 5: 139,150,317 L24P unknown Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Foxn4 C A 5: 114,258,655 E256* probably null Het
Gm4869 A G 5: 140,471,670 D398G probably benign Het
Gm5580 G A 6: 116,551,477 R105Q probably damaging Het
Gm5930 A G 14: 44,336,557 S108P probably damaging Het
Gnl3 A G 14: 31,013,232 S468P probably benign Het
Gzmb A T 14: 56,262,119 S11T probably benign Het
Hmcn1 T C 1: 150,733,129 probably null Het
Ifi206 A G 1: 173,473,862 L750P unknown Het
Ifi213 T A 1: 173,595,125 E58V probably damaging Het
Igkv4-78 A T 6: 69,059,768 Y94N probably damaging Het
Igsf9 G T 1: 172,491,757 probably null Het
Itpr2 G T 6: 146,158,949 L2490M possibly damaging Het
Kdm2b A G 5: 122,880,791 F862S probably damaging Het
Meis1 A G 11: 19,011,351 I174T probably damaging Het
Micu3 A G 8: 40,382,125 Q507R probably benign Het
Mpp4 C T 1: 59,143,810 E313K possibly damaging Het
Nfatc4 G A 14: 55,825,055 E7K probably damaging Het
Olfr466 T A 13: 65,152,842 V206D possibly damaging Het
Olfr828 A T 9: 18,816,190 Y35N probably damaging Het
Osbpl5 G A 7: 143,701,278 P470S probably damaging Het
Pak6 A G 2: 118,693,591 D409G possibly damaging Het
Pkhd1l1 T A 15: 44,498,590 M553K probably benign Het
Ppp2r3a T C 9: 101,212,672 N151D probably damaging Het
Prdm12 T C 2: 31,643,850 W160R probably damaging Het
Prdm2 G A 4: 143,132,901 T1273M possibly damaging Het
Prl2a1 A G 13: 27,807,370 probably null Het
Prob1 G A 18: 35,654,550 P217L possibly damaging Het
Ramp1 A C 1: 91,196,777 H20P probably benign Het
Rbm47 T A 5: 66,026,750 E170V possibly damaging Het
Rpn1 C T 6: 88,090,084 P142L probably damaging Het
Rsu1 C T 2: 13,170,016 R238H probably damaging Het
Sh3rf3 C T 10: 59,071,973 P441L probably damaging Het
Slc1a6 A G 10: 78,814,604 S559G possibly damaging Het
Slc35f5 C A 1: 125,572,485 S245R probably damaging Het
Spcs3 T C 8: 54,526,519 N76D probably benign Het
Svep1 T C 4: 58,111,395 T1075A possibly damaging Het
Sympk A T 7: 19,036,030 I211F probably benign Het
Tk1 C T 11: 117,825,777 M1I probably null Het
Tln2 A G 9: 67,346,461 V776A probably benign Het
Tmem94 G T 11: 115,786,256 R118L possibly damaging Het
Tnk2 T C 16: 32,680,800 V977A probably benign Het
Toporsl A T 4: 52,611,630 S508C probably benign Het
Trank1 A C 9: 111,377,870 R1690S probably benign Het
Trio T A 15: 27,828,351 Q1409L possibly damaging Het
Vit T C 17: 78,605,498 F287L probably benign Het
Vmn2r109 G C 17: 20,541,438 D552E probably benign Het
Zw10 T C 9: 49,061,191 V186A probably benign Het
Other mutations in 4930553M12Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:4930553M12Rik APN 4 88868073 nonsense probably null
R0194:4930553M12Rik UTSW 4 88868243 missense unknown
R2143:4930553M12Rik UTSW 4 88868174 missense unknown
R2143:4930553M12Rik UTSW 4 88868175 missense unknown
R2144:4930553M12Rik UTSW 4 88868174 missense unknown
R2144:4930553M12Rik UTSW 4 88868175 missense unknown
R5135:4930553M12Rik UTSW 4 88868271 missense unknown
R5822:4930553M12Rik UTSW 4 88868359 missense unknown
R5848:4930553M12Rik UTSW 4 88868359 missense unknown
R5849:4930553M12Rik UTSW 4 88868359 missense unknown
R5850:4930553M12Rik UTSW 4 88868359 missense unknown
R5854:4930553M12Rik UTSW 4 88868359 missense unknown
R5856:4930553M12Rik UTSW 4 88868359 missense unknown
R6128:4930553M12Rik UTSW 4 88868359 missense unknown
R6130:4930553M12Rik UTSW 4 88868359 missense unknown
R7054:4930553M12Rik UTSW 4 88868249 missense unknown
R7754:4930553M12Rik UTSW 4 88868259 missense unknown
R7844:4930553M12Rik UTSW 4 88868186 missense unknown
R7980:4930553M12Rik UTSW 4 88868078 missense unknown
Predicted Primers PCR Primer
(F):5'- TGTGCAGTCAGTGATGTGCAC -3'
(R):5'- GCCTTCTGGGATGAGGATAAC -3'

Sequencing Primer
(F):5'- GTGCGGACCAATATGCACC -3'
(R):5'- CTGGGATGAGGATAACGGGGG -3'
Posted On2019-06-26