Incidental Mutation 'R7292:Abcc8'
ID566489
Institutional Source Beutler Lab
Gene Symbol Abcc8
Ensembl Gene ENSMUSG00000040136
Gene NameATP-binding cassette, sub-family C (CFTR/MRP), member 8
SynonymsD930031B21Rik, SUR1, Sur
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.596) question?
Stock #R7292 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location46104523-46180033 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 46135526 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 726 (T726I)
Ref Sequence ENSEMBL: ENSMUSP00000033123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033123]
Predicted Effect probably benign
Transcript: ENSMUST00000033123
AA Change: T726I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000033123
Gene: ENSMUSG00000040136
AA Change: T726I

DomainStartEndE-ValueType
transmembrane domain 30 52 N/A INTRINSIC
transmembrane domain 73 95 N/A INTRINSIC
transmembrane domain 105 124 N/A INTRINSIC
transmembrane domain 131 148 N/A INTRINSIC
transmembrane domain 168 190 N/A INTRINSIC
Pfam:ABC_membrane 299 590 1.3e-39 PFAM
AAA 705 920 4.46e-14 SMART
low complexity region 972 994 N/A INTRINSIC
Pfam:ABC_membrane 1019 1301 1.3e-49 PFAM
AAA 1377 1570 4.33e-12 SMART
Predicted Effect
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. This protein functions as a modulator of ATP-sensitive potassium channels and insulin release. Mutations and deficiencies in this protein have been observed in patients with hyperinsulinemic hypoglycemia of infancy, an autosomal recessive disorder of unregulated and high insulin secretion. Mutations have also been associated with non-insulin-dependent diabetes mellitus type II, an autosomal dominant disease of defective insulin secretion. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygotes for targeted null mutations exhibit a transient neonatal hypoglycemia and a late-developing glucose intolerance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,466,110 probably benign Het
1700010I14Rik T A 17: 8,997,029 C322* probably null Het
1700019N19Rik A T 19: 58,789,107 Y90* probably null Het
2310035C23Rik G T 1: 105,721,416 probably null Het
4930553M12Rik G A 4: 88,868,331 R17C unknown Het
Adamts18 T C 8: 113,709,645 T981A probably benign Het
Adgrb3 A G 1: 25,531,876 C507R probably damaging Het
Bloc1s6 T A 2: 122,742,695 D63E probably damaging Het
Cdc25b C T 2: 131,191,173 R135W probably damaging Het
Cdca2 G T 14: 67,677,877 Y644* probably null Het
Ceacam10 G T 7: 24,778,350 G97C probably damaging Het
Cenpf G A 1: 189,650,694 L2668F probably damaging Het
Cog4 A G 8: 110,881,828 D774G probably damaging Het
Col11a2 G A 17: 34,051,508 G511E unknown Het
Col19a1 T A 1: 24,530,008 I220F unknown Het
Cubn G T 2: 13,424,739 T1317K probably damaging Het
Dnaaf5 T C 5: 139,150,317 L24P unknown Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Foxn4 C A 5: 114,258,655 E256* probably null Het
Gm4869 A G 5: 140,471,670 D398G probably benign Het
Gm5580 G A 6: 116,551,477 R105Q probably damaging Het
Gm5930 A G 14: 44,336,557 S108P probably damaging Het
Gnl3 A G 14: 31,013,232 S468P probably benign Het
Gzmb A T 14: 56,262,119 S11T probably benign Het
Hmcn1 T C 1: 150,733,129 probably null Het
Ifi206 A G 1: 173,473,862 L750P unknown Het
Ifi213 T A 1: 173,595,125 E58V probably damaging Het
Igkv4-78 A T 6: 69,059,768 Y94N probably damaging Het
Igsf9 G T 1: 172,491,757 probably null Het
Itpr2 G T 6: 146,158,949 L2490M possibly damaging Het
Kdm2b A G 5: 122,880,791 F862S probably damaging Het
Meis1 A G 11: 19,011,351 I174T probably damaging Het
Micu3 A G 8: 40,382,125 Q507R probably benign Het
Mpp4 C T 1: 59,143,810 E313K possibly damaging Het
Nfatc4 G A 14: 55,825,055 E7K probably damaging Het
Olfr466 T A 13: 65,152,842 V206D possibly damaging Het
Olfr828 A T 9: 18,816,190 Y35N probably damaging Het
Osbpl5 G A 7: 143,701,278 P470S probably damaging Het
Pak6 A G 2: 118,693,591 D409G possibly damaging Het
Pkhd1l1 T A 15: 44,498,590 M553K probably benign Het
Ppp2r3a T C 9: 101,212,672 N151D probably damaging Het
Prdm12 T C 2: 31,643,850 W160R probably damaging Het
Prdm2 G A 4: 143,132,901 T1273M possibly damaging Het
Prl2a1 A G 13: 27,807,370 probably null Het
Prob1 G A 18: 35,654,550 P217L possibly damaging Het
Ramp1 A C 1: 91,196,777 H20P probably benign Het
Rbm47 T A 5: 66,026,750 E170V possibly damaging Het
Rpn1 C T 6: 88,090,084 P142L probably damaging Het
Rsu1 C T 2: 13,170,016 R238H probably damaging Het
Sh3rf3 C T 10: 59,071,973 P441L probably damaging Het
Slc1a6 A G 10: 78,814,604 S559G possibly damaging Het
Slc35f5 C A 1: 125,572,485 S245R probably damaging Het
Spcs3 T C 8: 54,526,519 N76D probably benign Het
Svep1 T C 4: 58,111,395 T1075A possibly damaging Het
Sympk A T 7: 19,036,030 I211F probably benign Het
Tk1 C T 11: 117,825,777 M1I probably null Het
Tln2 A G 9: 67,346,461 V776A probably benign Het
Tmem94 G T 11: 115,786,256 R118L possibly damaging Het
Tnk2 T C 16: 32,680,800 V977A probably benign Het
Toporsl A T 4: 52,611,630 S508C probably benign Het
Trank1 A C 9: 111,377,870 R1690S probably benign Het
Trio T A 15: 27,828,351 Q1409L possibly damaging Het
Vit T C 17: 78,605,498 F287L probably benign Het
Vmn2r109 G C 17: 20,541,438 D552E probably benign Het
Zw10 T C 9: 49,061,191 V186A probably benign Het
Other mutations in Abcc8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01114:Abcc8 APN 7 46104664 missense probably benign
IGL01457:Abcc8 APN 7 46135493 missense possibly damaging 0.51
IGL01645:Abcc8 APN 7 46115053 missense possibly damaging 0.93
IGL01683:Abcc8 APN 7 46151667 missense possibly damaging 0.78
IGL01826:Abcc8 APN 7 46124849 missense probably benign 0.01
IGL01912:Abcc8 APN 7 46120510 missense probably damaging 1.00
IGL02218:Abcc8 APN 7 46120436 missense probably benign 0.00
IGL02326:Abcc8 APN 7 46122857 critical splice donor site probably null
IGL02403:Abcc8 APN 7 46105803 splice site probably null
IGL02411:Abcc8 APN 7 46107007 missense probably damaging 1.00
IGL02653:Abcc8 APN 7 46115767 splice site probably benign
IGL02706:Abcc8 APN 7 46166921 missense probably benign 0.08
R0295:Abcc8 UTSW 7 46118054 missense probably benign
R0381:Abcc8 UTSW 7 46108434 missense possibly damaging 0.46
R0391:Abcc8 UTSW 7 46122173 missense probably damaging 0.98
R0408:Abcc8 UTSW 7 46107033 missense probably damaging 0.99
R0496:Abcc8 UTSW 7 46108820 missense probably damaging 1.00
R1126:Abcc8 UTSW 7 46109638 missense probably damaging 0.99
R1323:Abcc8 UTSW 7 46117362 missense probably benign 0.07
R1323:Abcc8 UTSW 7 46117362 missense probably benign 0.07
R1352:Abcc8 UTSW 7 46135468 splice site probably benign
R1368:Abcc8 UTSW 7 46122860 missense probably damaging 1.00
R1437:Abcc8 UTSW 7 46179813 missense probably damaging 1.00
R1463:Abcc8 UTSW 7 46154512 missense probably benign 0.12
R1689:Abcc8 UTSW 7 46120403 missense probably benign 0.16
R1717:Abcc8 UTSW 7 46115815 missense possibly damaging 0.91
R1804:Abcc8 UTSW 7 46120479 missense probably benign 0.02
R1848:Abcc8 UTSW 7 46166902 missense probably benign
R1870:Abcc8 UTSW 7 46123915 missense probably benign 0.05
R1938:Abcc8 UTSW 7 46175371 missense possibly damaging 0.49
R1993:Abcc8 UTSW 7 46117423 splice site probably null
R1994:Abcc8 UTSW 7 46157119 missense probably benign 0.02
R2511:Abcc8 UTSW 7 46150780 missense probably damaging 1.00
R3840:Abcc8 UTSW 7 46108100 missense possibly damaging 0.67
R3879:Abcc8 UTSW 7 46104627 missense possibly damaging 0.90
R4444:Abcc8 UTSW 7 46136194 missense probably benign 0.09
R4463:Abcc8 UTSW 7 46106581 splice site probably null
R4761:Abcc8 UTSW 7 46113075 missense probably damaging 1.00
R4816:Abcc8 UTSW 7 46104707 missense probably benign 0.01
R4841:Abcc8 UTSW 7 46150828 missense probably damaging 1.00
R4842:Abcc8 UTSW 7 46150828 missense probably damaging 1.00
R4870:Abcc8 UTSW 7 46107259 nonsense probably null
R4969:Abcc8 UTSW 7 46105519 missense probably benign 0.02
R4975:Abcc8 UTSW 7 46150867 missense probably damaging 0.98
R5258:Abcc8 UTSW 7 46108387 missense probably benign
R5258:Abcc8 UTSW 7 46157148 missense probably benign 0.17
R5502:Abcc8 UTSW 7 46108838 missense probably benign 0.00
R5518:Abcc8 UTSW 7 46120449 missense probably benign
R5660:Abcc8 UTSW 7 46108404 missense probably benign 0.15
R5902:Abcc8 UTSW 7 46115039 missense probably benign
R5907:Abcc8 UTSW 7 46123906 missense probably benign 0.01
R6023:Abcc8 UTSW 7 46108419 missense possibly damaging 0.62
R6026:Abcc8 UTSW 7 46167000 missense probably benign
R6078:Abcc8 UTSW 7 46105844 missense probably benign 0.01
R6079:Abcc8 UTSW 7 46105844 missense probably benign 0.01
R6103:Abcc8 UTSW 7 46119021 missense possibly damaging 0.50
R6221:Abcc8 UTSW 7 46175450 missense probably benign 0.01
R6511:Abcc8 UTSW 7 46150861 missense possibly damaging 0.82
R7046:Abcc8 UTSW 7 46122940 missense probably damaging 1.00
R7230:Abcc8 UTSW 7 46117388 missense probably benign
R7287:Abcc8 UTSW 7 46113110 missense probably damaging 1.00
R7299:Abcc8 UTSW 7 46105498 missense possibly damaging 0.62
R7411:Abcc8 UTSW 7 46165917 critical splice donor site probably null
R7693:Abcc8 UTSW 7 46178544 missense probably damaging 0.99
R7704:Abcc8 UTSW 7 46106644 missense probably damaging 0.98
U15987:Abcc8 UTSW 7 46105844 missense probably benign 0.01
Z1088:Abcc8 UTSW 7 46138065 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCACACAGCAAGGGTTAAATGG -3'
(R):5'- ATGGAGCTTCCCAGGGTTTC -3'

Sequencing Primer
(F):5'- GTTAAATGGACACGGATGATGATAC -3'
(R):5'- CTTCCCAGGGTTTCCAGGTG -3'
Posted On2019-06-26