Incidental Mutation 'R7292:Olfr466'
ID566506
Institutional Source Beutler Lab
Gene Symbol Olfr466
Ensembl Gene ENSMUSG00000049806
Gene Nameolfactory receptor 466
SynonymsGA_x6K02T2PB7A-3051266-3052192, MOR209-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R7292 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location65150240-65156152 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 65152842 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 206 (V206D)
Ref Sequence ENSEMBL: ENSMUSP00000149328 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058907] [ENSMUST00000214214]
Predicted Effect possibly damaging
Transcript: ENSMUST00000058907
AA Change: V206D

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000062692
Gene: ENSMUSG00000049806
AA Change: V206D

DomainStartEndE-ValueType
Pfam:7tm_4 29 305 2.8e-47 PFAM
Pfam:7tm_1 39 288 3.2e-18 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214214
AA Change: V206D

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,466,110 probably benign Het
1700010I14Rik T A 17: 8,997,029 C322* probably null Het
1700019N19Rik A T 19: 58,789,107 Y90* probably null Het
2310035C23Rik G T 1: 105,721,416 probably null Het
4930553M12Rik G A 4: 88,868,331 R17C unknown Het
Abcc8 G A 7: 46,135,526 T726I probably benign Het
Adamts18 T C 8: 113,709,645 T981A probably benign Het
Adgrb3 A G 1: 25,531,876 C507R probably damaging Het
Bloc1s6 T A 2: 122,742,695 D63E probably damaging Het
Cdc25b C T 2: 131,191,173 R135W probably damaging Het
Cdca2 G T 14: 67,677,877 Y644* probably null Het
Ceacam10 G T 7: 24,778,350 G97C probably damaging Het
Cenpf G A 1: 189,650,694 L2668F probably damaging Het
Cog4 A G 8: 110,881,828 D774G probably damaging Het
Col11a2 G A 17: 34,051,508 G511E unknown Het
Col19a1 T A 1: 24,530,008 I220F unknown Het
Cubn G T 2: 13,424,739 T1317K probably damaging Het
Dnaaf5 T C 5: 139,150,317 L24P unknown Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Foxn4 C A 5: 114,258,655 E256* probably null Het
Gm4869 A G 5: 140,471,670 D398G probably benign Het
Gm5580 G A 6: 116,551,477 R105Q probably damaging Het
Gm5930 A G 14: 44,336,557 S108P probably damaging Het
Gnl3 A G 14: 31,013,232 S468P probably benign Het
Gzmb A T 14: 56,262,119 S11T probably benign Het
Hmcn1 T C 1: 150,733,129 probably null Het
Ifi206 A G 1: 173,473,862 L750P unknown Het
Ifi213 T A 1: 173,595,125 E58V probably damaging Het
Igkv4-78 A T 6: 69,059,768 Y94N probably damaging Het
Igsf9 G T 1: 172,491,757 probably null Het
Itpr2 G T 6: 146,158,949 L2490M possibly damaging Het
Kdm2b A G 5: 122,880,791 F862S probably damaging Het
Meis1 A G 11: 19,011,351 I174T probably damaging Het
Micu3 A G 8: 40,382,125 Q507R probably benign Het
Mpp4 C T 1: 59,143,810 E313K possibly damaging Het
Nfatc4 G A 14: 55,825,055 E7K probably damaging Het
Olfr828 A T 9: 18,816,190 Y35N probably damaging Het
Osbpl5 G A 7: 143,701,278 P470S probably damaging Het
Pak6 A G 2: 118,693,591 D409G possibly damaging Het
Pkhd1l1 T A 15: 44,498,590 M553K probably benign Het
Ppp2r3a T C 9: 101,212,672 N151D probably damaging Het
Prdm12 T C 2: 31,643,850 W160R probably damaging Het
Prdm2 G A 4: 143,132,901 T1273M possibly damaging Het
Prl2a1 A G 13: 27,807,370 probably null Het
Prob1 G A 18: 35,654,550 P217L possibly damaging Het
Ramp1 A C 1: 91,196,777 H20P probably benign Het
Rbm47 T A 5: 66,026,750 E170V possibly damaging Het
Rpn1 C T 6: 88,090,084 P142L probably damaging Het
Rsu1 C T 2: 13,170,016 R238H probably damaging Het
Sh3rf3 C T 10: 59,071,973 P441L probably damaging Het
Slc1a6 A G 10: 78,814,604 S559G possibly damaging Het
Slc35f5 C A 1: 125,572,485 S245R probably damaging Het
Spcs3 T C 8: 54,526,519 N76D probably benign Het
Svep1 T C 4: 58,111,395 T1075A possibly damaging Het
Sympk A T 7: 19,036,030 I211F probably benign Het
Tk1 C T 11: 117,825,777 M1I probably null Het
Tln2 A G 9: 67,346,461 V776A probably benign Het
Tmem94 G T 11: 115,786,256 R118L possibly damaging Het
Tnk2 T C 16: 32,680,800 V977A probably benign Het
Toporsl A T 4: 52,611,630 S508C probably benign Het
Trank1 A C 9: 111,377,870 R1690S probably benign Het
Trio T A 15: 27,828,351 Q1409L possibly damaging Het
Vit T C 17: 78,605,498 F287L probably benign Het
Vmn2r109 G C 17: 20,541,438 D552E probably benign Het
Zw10 T C 9: 49,061,191 V186A probably benign Het
Other mutations in Olfr466
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02684:Olfr466 APN 13 65152396 missense probably damaging 0.99
R0269:Olfr466 UTSW 13 65152878 missense possibly damaging 0.56
R0617:Olfr466 UTSW 13 65152878 missense possibly damaging 0.56
R0646:Olfr466 UTSW 13 65153063 missense probably damaging 1.00
R1338:Olfr466 UTSW 13 65152383 missense probably damaging 1.00
R1893:Olfr466 UTSW 13 65152992 missense possibly damaging 0.92
R3108:Olfr466 UTSW 13 65153061 missense possibly damaging 0.89
R4408:Olfr466 UTSW 13 65152700 missense probably benign 0.00
R4625:Olfr466 UTSW 13 65152860 missense possibly damaging 0.95
R4732:Olfr466 UTSW 13 65152653 missense possibly damaging 0.72
R4733:Olfr466 UTSW 13 65152653 missense possibly damaging 0.72
R4849:Olfr466 UTSW 13 65152679 missense possibly damaging 0.96
R5058:Olfr466 UTSW 13 65152929 missense possibly damaging 0.96
R5419:Olfr466 UTSW 13 65152774 missense probably damaging 1.00
R5569:Olfr466 UTSW 13 65152979 missense possibly damaging 0.81
R5662:Olfr466 UTSW 13 65152253 missense possibly damaging 0.76
R7345:Olfr466 UTSW 13 65152743 missense possibly damaging 0.59
R7427:Olfr466 UTSW 13 65153052 missense probably damaging 1.00
R7428:Olfr466 UTSW 13 65153052 missense probably damaging 1.00
R8162:Olfr466 UTSW 13 65152920 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGTATGTCCCACTGGGTCTG -3'
(R):5'- TTTGCTCTGCTCCATGGAGG -3'

Sequencing Primer
(F):5'- ATCAGGGTCCTATTCATGGGG -3'
(R):5'- TCCATGGAGGAGACAGCACTG -3'
Posted On2019-06-26