Incidental Mutation 'R7292:Gnl3'
ID566507
Institutional Source Beutler Lab
Gene Symbol Gnl3
Ensembl Gene ENSMUSG00000042354
Gene Nameguanine nucleotide binding protein-like 3 (nucleolar)
Synonymsnucleostemin, NS
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7292 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location31012433-31019152 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 31013232 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 468 (S468P)
Ref Sequence ENSEMBL: ENSMUSP00000047119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022476] [ENSMUST00000037739] [ENSMUST00000168584] [ENSMUST00000226378] [ENSMUST00000226740] [ENSMUST00000227467] [ENSMUST00000228341]
Predicted Effect probably benign
Transcript: ENSMUST00000022476
SMART Domains Protein: ENSMUSP00000022476
Gene: ENSMUSG00000021916

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
Pfam:Glyco_transf_8 67 340 1.7e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000037739
AA Change: S468P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000047119
Gene: ENSMUSG00000042354
AA Change: S468P

DomainStartEndE-ValueType
Pfam:GN3L_Grn1 16 90 4.3e-25 PFAM
low complexity region 112 126 N/A INTRINSIC
SCOP:d1egaa1 130 207 3e-3 SMART
low complexity region 209 220 N/A INTRINSIC
Pfam:MMR_HSR1 251 362 2.3e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168584
SMART Domains Protein: ENSMUSP00000129323
Gene: ENSMUSG00000021916

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
Pfam:Glyco_transf_8 67 340 8.6e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226378
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000226740
Predicted Effect probably benign
Transcript: ENSMUST00000227467
Predicted Effect probably benign
Transcript: ENSMUST00000228341
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene may interact with p53 and may be involved in tumorigenesis. The encoded protein also appears to be important for stem cell proliferation. This protein is found in both the nucleus and nucleolus. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]
PHENOTYPE: Homozygous disruption of this gene leads to early embryonic loss as blastocysts fail to enter the S phase. MEFs heterozygous for a gene trap allele have reduced proliferative capacity while MEFs heterozygous for a null allele show reduced doubling rates,increased apoptosis and premature senescence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,466,110 probably benign Het
1700010I14Rik T A 17: 8,997,029 C322* probably null Het
1700019N19Rik A T 19: 58,789,107 Y90* probably null Het
2310035C23Rik G T 1: 105,721,416 probably null Het
4930553M12Rik G A 4: 88,868,331 R17C unknown Het
Abcc8 G A 7: 46,135,526 T726I probably benign Het
Adamts18 T C 8: 113,709,645 T981A probably benign Het
Adgrb3 A G 1: 25,531,876 C507R probably damaging Het
Bloc1s6 T A 2: 122,742,695 D63E probably damaging Het
Cdc25b C T 2: 131,191,173 R135W probably damaging Het
Cdca2 G T 14: 67,677,877 Y644* probably null Het
Ceacam10 G T 7: 24,778,350 G97C probably damaging Het
Cenpf G A 1: 189,650,694 L2668F probably damaging Het
Cog4 A G 8: 110,881,828 D774G probably damaging Het
Col11a2 G A 17: 34,051,508 G511E unknown Het
Col19a1 T A 1: 24,530,008 I220F unknown Het
Cubn G T 2: 13,424,739 T1317K probably damaging Het
Dnaaf5 T C 5: 139,150,317 L24P unknown Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Foxn4 C A 5: 114,258,655 E256* probably null Het
Gm4869 A G 5: 140,471,670 D398G probably benign Het
Gm5580 G A 6: 116,551,477 R105Q probably damaging Het
Gm5930 A G 14: 44,336,557 S108P probably damaging Het
Gzmb A T 14: 56,262,119 S11T probably benign Het
Hmcn1 T C 1: 150,733,129 probably null Het
Ifi206 A G 1: 173,473,862 L750P unknown Het
Ifi213 T A 1: 173,595,125 E58V probably damaging Het
Igkv4-78 A T 6: 69,059,768 Y94N probably damaging Het
Igsf9 G T 1: 172,491,757 probably null Het
Itpr2 G T 6: 146,158,949 L2490M possibly damaging Het
Kdm2b A G 5: 122,880,791 F862S probably damaging Het
Meis1 A G 11: 19,011,351 I174T probably damaging Het
Micu3 A G 8: 40,382,125 Q507R probably benign Het
Mpp4 C T 1: 59,143,810 E313K possibly damaging Het
Nfatc4 G A 14: 55,825,055 E7K probably damaging Het
Olfr466 T A 13: 65,152,842 V206D possibly damaging Het
Olfr828 A T 9: 18,816,190 Y35N probably damaging Het
Osbpl5 G A 7: 143,701,278 P470S probably damaging Het
Pak6 A G 2: 118,693,591 D409G possibly damaging Het
Pkhd1l1 T A 15: 44,498,590 M553K probably benign Het
Ppp2r3a T C 9: 101,212,672 N151D probably damaging Het
Prdm12 T C 2: 31,643,850 W160R probably damaging Het
Prdm2 G A 4: 143,132,901 T1273M possibly damaging Het
Prl2a1 A G 13: 27,807,370 probably null Het
Prob1 G A 18: 35,654,550 P217L possibly damaging Het
Ramp1 A C 1: 91,196,777 H20P probably benign Het
Rbm47 T A 5: 66,026,750 E170V possibly damaging Het
Rpn1 C T 6: 88,090,084 P142L probably damaging Het
Rsu1 C T 2: 13,170,016 R238H probably damaging Het
Sh3rf3 C T 10: 59,071,973 P441L probably damaging Het
Slc1a6 A G 10: 78,814,604 S559G possibly damaging Het
Slc35f5 C A 1: 125,572,485 S245R probably damaging Het
Spcs3 T C 8: 54,526,519 N76D probably benign Het
Svep1 T C 4: 58,111,395 T1075A possibly damaging Het
Sympk A T 7: 19,036,030 I211F probably benign Het
Tk1 C T 11: 117,825,777 M1I probably null Het
Tln2 A G 9: 67,346,461 V776A probably benign Het
Tmem94 G T 11: 115,786,256 R118L possibly damaging Het
Tnk2 T C 16: 32,680,800 V977A probably benign Het
Toporsl A T 4: 52,611,630 S508C probably benign Het
Trank1 A C 9: 111,377,870 R1690S probably benign Het
Trio T A 15: 27,828,351 Q1409L possibly damaging Het
Vit T C 17: 78,605,498 F287L probably benign Het
Vmn2r109 G C 17: 20,541,438 D552E probably benign Het
Zw10 T C 9: 49,061,191 V186A probably benign Het
Other mutations in Gnl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00809:Gnl3 APN 14 31014189 missense possibly damaging 0.71
IGL00826:Gnl3 APN 14 31012796 unclassified probably benign
IGL02323:Gnl3 APN 14 31017402 missense probably damaging 1.00
R0277:Gnl3 UTSW 14 31013427 critical splice donor site probably null
R0636:Gnl3 UTSW 14 31017153 missense probably damaging 1.00
R0727:Gnl3 UTSW 14 31017077 missense probably damaging 0.99
R1459:Gnl3 UTSW 14 31017846 missense probably damaging 1.00
R1474:Gnl3 UTSW 14 31016461 splice site probably benign
R2016:Gnl3 UTSW 14 31016369 unclassified probably null
R2352:Gnl3 UTSW 14 31016826 critical splice donor site probably null
R2517:Gnl3 UTSW 14 31014163 missense probably damaging 1.00
R4115:Gnl3 UTSW 14 31016856 missense probably damaging 1.00
R4697:Gnl3 UTSW 14 31017329 missense probably damaging 0.98
R4853:Gnl3 UTSW 14 31015313 missense probably damaging 0.99
R4973:Gnl3 UTSW 14 31013505 missense possibly damaging 0.68
R5091:Gnl3 UTSW 14 31016846 missense possibly damaging 0.76
R5580:Gnl3 UTSW 14 31015285 missense probably benign
R5914:Gnl3 UTSW 14 31016896 missense possibly damaging 0.85
R6898:Gnl3 UTSW 14 31013179 missense probably benign 0.01
R7372:Gnl3 UTSW 14 31016886 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CAGGGGTCCCTTCTTATTAAAATG -3'
(R):5'- GCAGTCATGAAGAAGGGCTTTAATC -3'

Sequencing Primer
(F):5'- AAAATGTTTCTACCTTTGACCCTC -3'
(R):5'- CACAGCATACAAGGTGAAATTCTG -3'
Posted On2019-06-26