Mutagenetix > Incidental Mutation

Incidental Mutation 'R7292:Trio'

566511

Institutional Source

Beutler Lab

Gene Symbol

Trio

Ensembl Gene

ENSMUSG00000022263

Gene Name

triple functional domain (PTPRF interacting)

Synonyms

Solo, 6720464I07Rik

MMRRC Submission

045397-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7292 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

27730737-28025934 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 27828437 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 1409 (Q1409L)

Ref Sequence

ENSEMBL: ENSMUSP00000087714 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090247] [ENSMUST00000226644] [ENSMUST00000227337]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000090247
AA Change: Q1409L

PolyPhen 2 Score 0.631 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000087714
Gene: ENSMUSG00000022263
AA Change: Q1409L

Domain	Start	End	E-Value	Type
low complexity region	2	40	N/A	INTRINSIC
SEC14	68	207	3.4e-26	SMART
SPEC	221	337	2.48e-9	SMART
SPEC	343	445	1.92e-15	SMART
SPEC	569	671	5.35e-14	SMART
SPEC	674	783	1.18e-6	SMART
SPEC	910	1011	2.6e-12	SMART
SPEC	1141	1243	7e-18	SMART
low complexity region	1249	1258	N/A	INTRINSIC
RhoGEF	1296	1466	2.79e-53	SMART
PH	1480	1593	1.53e-9	SMART
SH3	1659	1720	1.9e-8	SMART
low complexity region	1788	1802	N/A	INTRINSIC
low complexity region	1837	1863	N/A	INTRINSIC
low complexity region	1936	1954	N/A	INTRINSIC
RhoGEF	1973	2144	1.32e-63	SMART
PH	2158	2273	3.6e-6	SMART
low complexity region	2291	2341	N/A	INTRINSIC
low complexity region	2371	2390	N/A	INTRINSIC
low complexity region	2491	2503	N/A	INTRINSIC
SH3	2558	2619	1.04e0	SMART
low complexity region	2640	2660	N/A	INTRINSIC
IGc2	2701	2770	4e-12	SMART
S_TKc	2800	3054	4.84e-72	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000226644
AA Change: Q265L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

probably damaging
Transcript: ENSMUST00000227337
AA Change: Q1350L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (66/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large protein that functions as a GDP to GTP exchange factor. This protein promotes the reorganization of the actin cytoskeleton, thereby playing a role in cell migration and growth. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous mutant mice die during late embryonic development or shortly after birth. They exhibit abnormal skeletal myogenesis and display aberrant organization within the hippocampus and olfactory bulb. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700010I14Rik	T	A	17: 9,215,861 (GRCm39)	C322*	probably null	Het
4930553M12Rik	G	A	4: 88,786,568 (GRCm39)	R17C	unknown	Het
Abcc8	G	A	7: 45,784,950 (GRCm39)	T726I	probably benign	Het
Adamts18	T	C	8: 114,436,277 (GRCm39)	T981A	probably benign	Het
Adgrb3	A	G	1: 25,570,957 (GRCm39)	C507R	probably damaging	Het
Bloc1s6	T	A	2: 122,584,615 (GRCm39)	D63E	probably damaging	Het
Cdc25b	C	T	2: 131,033,093 (GRCm39)	R135W	probably damaging	Het
Cdca2	G	T	14: 67,915,326 (GRCm39)	Y644*	probably null	Het
Ceacam10	G	T	7: 24,477,775 (GRCm39)	G97C	probably damaging	Het
Cenpf	G	A	1: 189,382,891 (GRCm39)	L2668F	probably damaging	Het
Cog4	A	G	8: 111,608,460 (GRCm39)	D774G	probably damaging	Het
Col11a2	G	A	17: 34,270,482 (GRCm39)	G511E	unknown	Het
Col19a1	T	A	1: 24,569,089 (GRCm39)	I220F	unknown	Het
Cubn	G	T	2: 13,429,550 (GRCm39)	T1317K	probably damaging	Het
Dnaaf5	T	C	5: 139,136,072 (GRCm39)	L24P	unknown	Het
Eif4a3l2	G	A	6: 116,528,438 (GRCm39)	R105Q	probably damaging	Het
Fan1	T	A	7: 64,022,234 (GRCm39)	N340Y	probably damaging	Het
Foxn4	C	A	5: 114,396,716 (GRCm39)	E256*	probably null	Het
Gm5930	A	G	14: 44,574,014 (GRCm39)	S108P	probably damaging	Het
Gnl3	A	G	14: 30,735,189 (GRCm39)	S468P	probably benign	Het
Gzmb	A	T	14: 56,499,576 (GRCm39)	S11T	probably benign	Het
Hmcn1	T	C	1: 150,608,880 (GRCm39)		probably null	Het
Ifi206	A	G	1: 173,301,428 (GRCm39)	L750P	unknown	Het
Ifi213	T	A	1: 173,422,691 (GRCm39)	E58V	probably damaging	Het
Igkv4-78	A	T	6: 69,036,752 (GRCm39)	Y94N	probably damaging	Het
Igsf9	G	T	1: 172,319,324 (GRCm39)		probably null	Het
Itpr2	G	T	6: 146,060,447 (GRCm39)	L2490M	possibly damaging	Het
Kdm2b	A	G	5: 123,018,854 (GRCm39)	F862S	probably damaging	Het
Kif19b	A	G	5: 140,457,425 (GRCm39)	D398G	probably benign	Het
Meis1	A	G	11: 18,961,351 (GRCm39)	I174T	probably damaging	Het
Micu3	A	G	8: 40,835,166 (GRCm39)	Q507R	probably benign	Het
Mpp4	C	T	1: 59,182,969 (GRCm39)	E313K	possibly damaging	Het
Nfatc4	G	A	14: 56,062,512 (GRCm39)	E7K	probably damaging	Het
Or7g16	A	T	9: 18,727,486 (GRCm39)	Y35N	probably damaging	Het
Or9s18	T	A	13: 65,300,656 (GRCm39)	V206D	possibly damaging	Het
Osbpl5	G	A	7: 143,255,015 (GRCm39)	P470S	probably damaging	Het
Pak6	A	G	2: 118,524,072 (GRCm39)	D409G	possibly damaging	Het
Pierce1	TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC	TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC	2: 28,356,122 (GRCm39)		probably benign	Het
Pkhd1l1	T	A	15: 44,361,986 (GRCm39)	M553K	probably benign	Het
Ppp2r3d	T	C	9: 101,089,871 (GRCm39)	N151D	probably damaging	Het
Prdm12	T	C	2: 31,533,862 (GRCm39)	W160R	probably damaging	Het
Prdm2	G	A	4: 142,859,471 (GRCm39)	T1273M	possibly damaging	Het
Prl2a1	A	G	13: 27,991,353 (GRCm39)		probably null	Het
Prob1	G	A	18: 35,787,603 (GRCm39)	P217L	possibly damaging	Het
Ramp1	A	C	1: 91,124,499 (GRCm39)	H20P	probably benign	Het
Rbm47	T	A	5: 66,184,093 (GRCm39)	E170V	possibly damaging	Het
Relch	G	T	1: 105,649,141 (GRCm39)		probably null	Het
Rpn1	C	T	6: 88,067,066 (GRCm39)	P142L	probably damaging	Het
Rsu1	C	T	2: 13,174,827 (GRCm39)	R238H	probably damaging	Het
Sh3rf3	C	T	10: 58,907,795 (GRCm39)	P441L	probably damaging	Het
Slc1a6	A	G	10: 78,650,438 (GRCm39)	S559G	possibly damaging	Het
Slc35f5	C	A	1: 125,500,222 (GRCm39)	S245R	probably damaging	Het
Spcs3	T	C	8: 54,979,554 (GRCm39)	N76D	probably benign	Het
Spmip5	A	T	19: 58,777,539 (GRCm39)	Y90*	probably null	Het
Svep1	T	C	4: 58,111,395 (GRCm39)	T1075A	possibly damaging	Het
Sympk	A	T	7: 18,769,955 (GRCm39)	I211F	probably benign	Het
Tk1	C	T	11: 117,716,603 (GRCm39)	M1I	probably null	Het
Tln2	A	G	9: 67,253,743 (GRCm39)	V776A	probably benign	Het
Tmem94	G	T	11: 115,677,082 (GRCm39)	R118L	possibly damaging	Het
Tnk2	T	C	16: 32,499,618 (GRCm39)	V977A	probably benign	Het
Toporsl	A	T	4: 52,611,630 (GRCm39)	S508C	probably benign	Het
Trank1	A	C	9: 111,206,938 (GRCm39)	R1690S	probably benign	Het
Vit	T	C	17: 78,912,927 (GRCm39)	F287L	probably benign	Het
Vmn2r109	G	C	17: 20,761,700 (GRCm39)	D552E	probably benign	Het
Zw10	T	C	9: 48,972,491 (GRCm39)	V186A	probably benign	Het

Other mutations in Trio

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00480:Trio	APN	15	27,912,829 (GRCm39)	splice site	probably benign
IGL01011:Trio	APN	15	27,736,575 (GRCm39)	missense	probably damaging	0.96
IGL01090:Trio	APN	15	27,773,093 (GRCm39)	missense	probably damaging	1.00
IGL01145:Trio	APN	15	27,818,253 (GRCm39)	splice site	probably benign
IGL01147:Trio	APN	15	27,881,406 (GRCm39)	missense	probably damaging	1.00
IGL01161:Trio	APN	15	27,749,867 (GRCm39)	missense	probably damaging	1.00
IGL01324:Trio	APN	15	27,905,409 (GRCm39)	missense	probably benign	0.42
IGL01352:Trio	APN	15	27,901,315 (GRCm39)	missense	probably benign	0.01
IGL01366:Trio	APN	15	27,732,954 (GRCm39)	missense	possibly damaging	0.76
IGL01443:Trio	APN	15	27,838,861 (GRCm39)	splice site	probably benign
IGL01454:Trio	APN	15	27,833,071 (GRCm39)	missense	probably benign	0.32
IGL01695:Trio	APN	15	27,773,087 (GRCm39)	missense	probably damaging	1.00
IGL01765:Trio	APN	15	27,764,112 (GRCm39)	missense	possibly damaging	0.85
IGL01860:Trio	APN	15	27,846,896 (GRCm39)	missense	probably damaging	1.00
IGL01879:Trio	APN	15	27,741,119 (GRCm39)	missense	probably benign	0.12
IGL01991:Trio	APN	15	27,871,360 (GRCm39)	missense	possibly damaging	0.95
IGL02106:Trio	APN	15	27,744,244 (GRCm39)	missense	possibly damaging	0.85
IGL02209:Trio	APN	15	27,744,139 (GRCm39)	missense	probably damaging	1.00
IGL02232:Trio	APN	15	27,902,647 (GRCm39)	missense	probably benign	0.24
IGL02304:Trio	APN	15	27,735,522 (GRCm39)	missense	probably damaging	0.96
IGL02504:Trio	APN	15	27,847,476 (GRCm39)	nonsense	probably null
IGL02508:Trio	APN	15	27,818,190 (GRCm39)	missense	possibly damaging	0.65
IGL02541:Trio	APN	15	27,845,016 (GRCm39)	splice site	probably benign
IGL02617:Trio	APN	15	27,841,935 (GRCm39)	splice site	probably benign
IGL02675:Trio	APN	15	27,768,125 (GRCm39)	unclassified	probably benign
IGL02817:Trio	APN	15	27,902,967 (GRCm39)	missense	probably benign	0.01
IGL02993:Trio	APN	15	27,830,325 (GRCm39)	splice site	probably benign
IGL03007:Trio	APN	15	27,902,828 (GRCm39)	missense	probably damaging	0.99
IGL03135:Trio	APN	15	27,832,097 (GRCm39)	splice site	probably benign
IGL03225:Trio	APN	15	27,902,781 (GRCm39)	missense	probably benign	0.30
R0063:Trio	UTSW	15	27,881,523 (GRCm39)	splice site	probably benign
R0063:Trio	UTSW	15	27,881,523 (GRCm39)	splice site	probably benign
R0302:Trio	UTSW	15	27,902,603 (GRCm39)	missense	probably damaging	1.00
R0505:Trio	UTSW	15	27,767,993 (GRCm39)	missense	probably benign	0.00
R0506:Trio	UTSW	15	27,855,049 (GRCm39)	missense	probably benign	0.12
R0564:Trio	UTSW	15	27,805,908 (GRCm39)	missense	probably damaging	1.00
R0659:Trio	UTSW	15	27,831,485 (GRCm39)	missense	probably damaging	0.97
R0882:Trio	UTSW	15	27,732,980 (GRCm39)	missense	probably damaging	1.00
R0939:Trio	UTSW	15	27,741,336 (GRCm39)	critical splice donor site	probably null
R1018:Trio	UTSW	15	27,871,257 (GRCm39)	missense	probably damaging	1.00
R1439:Trio	UTSW	15	27,898,000 (GRCm39)	missense	probably damaging	1.00
R1456:Trio	UTSW	15	27,753,890 (GRCm39)	splice site	probably benign
R1488:Trio	UTSW	15	27,741,053 (GRCm39)	missense	probably damaging	1.00
R1522:Trio	UTSW	15	27,732,726 (GRCm39)	missense	probably benign	0.28
R1531:Trio	UTSW	15	27,833,071 (GRCm39)	missense	probably benign	0.32
R1640:Trio	UTSW	15	27,833,130 (GRCm39)	missense	probably damaging	1.00
R1646:Trio	UTSW	15	27,758,433 (GRCm39)	missense	possibly damaging	0.91
R1682:Trio	UTSW	15	27,744,232 (GRCm39)	splice site	probably null
R1780:Trio	UTSW	15	27,744,124 (GRCm39)	missense	possibly damaging	0.93
R1791:Trio	UTSW	15	27,841,842 (GRCm39)	missense	probably damaging	1.00
R1803:Trio	UTSW	15	27,748,426 (GRCm39)	missense	probably benign
R1817:Trio	UTSW	15	27,742,581 (GRCm39)	nonsense	probably null
R1853:Trio	UTSW	15	27,756,622 (GRCm39)	missense	probably damaging	1.00
R1898:Trio	UTSW	15	27,742,466 (GRCm39)	missense	possibly damaging	0.52
R1937:Trio	UTSW	15	27,833,142 (GRCm39)	missense	probably damaging	1.00
R1938:Trio	UTSW	15	27,732,977 (GRCm39)	missense	probably damaging	0.98
R2025:Trio	UTSW	15	27,774,013 (GRCm39)	missense	probably damaging	1.00
R2025:Trio	UTSW	15	27,744,223 (GRCm39)	missense	probably damaging	0.99
R2050:Trio	UTSW	15	27,852,031 (GRCm39)	missense	possibly damaging	0.85
R2186:Trio	UTSW	15	27,824,061 (GRCm39)	splice site	probably null
R2913:Trio	UTSW	15	27,854,998 (GRCm39)	missense	probably damaging	1.00
R3151:Trio	UTSW	15	27,805,862 (GRCm39)	missense	probably damaging	1.00
R3771:Trio	UTSW	15	27,748,177 (GRCm39)	missense	probably damaging	0.98
R3773:Trio	UTSW	15	27,748,177 (GRCm39)	missense	probably damaging	0.98
R3826:Trio	UTSW	15	27,833,156 (GRCm39)	missense	probably damaging	1.00
R4015:Trio	UTSW	15	27,744,187 (GRCm39)	missense	possibly damaging	0.71
R4359:Trio	UTSW	15	27,749,883 (GRCm39)	nonsense	probably null
R4370:Trio	UTSW	15	27,748,423 (GRCm39)	nonsense	probably null
R4547:Trio	UTSW	15	27,819,068 (GRCm39)	missense	possibly damaging	0.89
R4573:Trio	UTSW	15	27,773,084 (GRCm39)	small deletion	probably benign
R4620:Trio	UTSW	15	27,871,257 (GRCm39)	missense	probably damaging	1.00
R4735:Trio	UTSW	15	27,752,875 (GRCm39)	splice site	probably null
R4764:Trio	UTSW	15	27,732,624 (GRCm39)	nonsense	probably null
R4775:Trio	UTSW	15	27,881,428 (GRCm39)	nonsense	probably null
R4942:Trio	UTSW	15	27,752,811 (GRCm39)	missense	probably benign	0.21
R5004:Trio	UTSW	15	27,755,264 (GRCm39)	missense	probably damaging	1.00
R5149:Trio	UTSW	15	27,754,115 (GRCm39)	missense	possibly damaging	0.74
R5183:Trio	UTSW	15	27,902,686 (GRCm39)	missense	probably benign	0.00
R5186:Trio	UTSW	15	27,898,077 (GRCm39)	missense	probably damaging	0.97
R5268:Trio	UTSW	15	27,748,372 (GRCm39)	missense	probably benign	0.02
R5344:Trio	UTSW	15	27,735,618 (GRCm39)	missense	probably benign	0.12
R5407:Trio	UTSW	15	27,844,892 (GRCm39)	splice site	probably null
R5442:Trio	UTSW	15	27,856,280 (GRCm39)	missense	probably benign	0.04
R5617:Trio	UTSW	15	27,902,834 (GRCm39)	missense	probably benign
R5778:Trio	UTSW	15	27,856,250 (GRCm39)	missense	probably benign	0.33
R5986:Trio	UTSW	15	27,852,019 (GRCm39)	missense	possibly damaging	0.88
R5990:Trio	UTSW	15	27,891,545 (GRCm39)	missense	probably benign	0.10
R6011:Trio	UTSW	15	27,735,631 (GRCm39)	missense	probably damaging	0.98
R6063:Trio	UTSW	15	27,891,465 (GRCm39)	missense	possibly damaging	0.94
R6166:Trio	UTSW	15	27,818,157 (GRCm39)	missense	probably damaging	0.96
R6187:Trio	UTSW	15	27,744,038 (GRCm39)	critical splice donor site	probably null
R6387:Trio	UTSW	15	27,752,825 (GRCm39)	missense	probably damaging	1.00
R6402:Trio	UTSW	15	27,902,997 (GRCm39)	missense	probably benign	0.02
R6478:Trio	UTSW	15	27,856,193 (GRCm39)	missense	probably benign	0.01
R6528:Trio	UTSW	15	27,805,956 (GRCm39)	missense	probably damaging	1.00
R6662:Trio	UTSW	15	27,855,082 (GRCm39)	missense	probably benign	0.00
R6825:Trio	UTSW	15	27,889,394 (GRCm39)	missense	probably damaging	0.98
R6890:Trio	UTSW	15	27,919,374 (GRCm39)	unclassified	probably benign
R6945:Trio	UTSW	15	27,824,176 (GRCm39)	missense	probably damaging	1.00
R7027:Trio	UTSW	15	27,805,740 (GRCm39)	missense	possibly damaging	0.86
R7046:Trio	UTSW	15	27,832,137 (GRCm39)	missense	probably damaging	1.00
R7049:Trio	UTSW	15	27,749,885 (GRCm39)	missense	possibly damaging	0.66
R7075:Trio	UTSW	15	27,898,086 (GRCm39)	missense	unknown
R7094:Trio	UTSW	15	27,891,534 (GRCm39)	missense	unknown
R7123:Trio	UTSW	15	27,742,399 (GRCm39)	critical splice donor site	probably benign
R7130:Trio	UTSW	15	27,742,399 (GRCm39)	critical splice donor site	probably benign
R7214:Trio	UTSW	15	27,871,273 (GRCm39)	missense	probably damaging	0.97
R7293:Trio	UTSW	15	27,871,375 (GRCm39)	missense	possibly damaging	0.66
R7352:Trio	UTSW	15	27,732,962 (GRCm39)	missense	probably damaging	0.96
R7426:Trio	UTSW	15	27,856,193 (GRCm39)	missense	probably benign	0.01
R7451:Trio	UTSW	15	27,747,999 (GRCm39)	missense	probably benign	0.07
R7558:Trio	UTSW	15	27,831,480 (GRCm39)	missense	possibly damaging	0.90
R7578:Trio	UTSW	15	27,855,025 (GRCm39)	missense	possibly damaging	0.94
R7596:Trio	UTSW	15	27,749,912 (GRCm39)	missense	probably damaging	0.99
R7604:Trio	UTSW	15	27,736,531 (GRCm39)	critical splice donor site	probably null
R7609:Trio	UTSW	15	27,912,728 (GRCm39)	missense	unknown
R7767:Trio	UTSW	15	27,889,504 (GRCm39)	missense	unknown
R7784:Trio	UTSW	15	27,764,080 (GRCm39)	missense	probably damaging	1.00
R7817:Trio	UTSW	15	27,749,952 (GRCm39)	missense	probably benign	0.35
R7833:Trio	UTSW	15	27,774,172 (GRCm39)	missense	probably damaging	0.99
R7873:Trio	UTSW	15	27,805,770 (GRCm39)	missense	possibly damaging	0.83
R7879:Trio	UTSW	15	27,852,010 (GRCm39)	missense	possibly damaging	0.94
R7989:Trio	UTSW	15	27,773,021 (GRCm39)	missense	probably damaging	0.97
R8022:Trio	UTSW	15	27,749,952 (GRCm39)	missense	probably benign	0.35
R8050:Trio	UTSW	15	27,891,540 (GRCm39)	missense	unknown
R8217:Trio	UTSW	15	27,819,055 (GRCm39)	missense	probably damaging	0.97
R8280:Trio	UTSW	15	27,902,996 (GRCm39)	missense	unknown
R8283:Trio	UTSW	15	27,756,628 (GRCm39)	missense	possibly damaging	0.79
R8300:Trio	UTSW	15	27,855,108 (GRCm39)	missense	possibly damaging	0.66
R8321:Trio	UTSW	15	27,881,412 (GRCm39)	missense	possibly damaging	0.90
R8477:Trio	UTSW	15	27,774,038 (GRCm39)	missense	possibly damaging	0.83
R8479:Trio	UTSW	15	27,901,286 (GRCm39)	missense	probably benign	0.25
R8682:Trio	UTSW	15	27,905,278 (GRCm39)	missense	unknown
R8688:Trio	UTSW	15	27,748,324 (GRCm39)	missense	possibly damaging	0.61
R8708:Trio	UTSW	15	27,732,632 (GRCm39)	missense	probably damaging	0.99
R8709:Trio	UTSW	15	27,919,323 (GRCm39)	missense	unknown
R8713:Trio	UTSW	15	27,744,037 (GRCm39)	critical splice donor site	probably benign
R8798:Trio	UTSW	15	27,851,923 (GRCm39)	missense	possibly damaging	0.92
R8812:Trio	UTSW	15	27,905,311 (GRCm39)	missense	unknown
R8816:Trio	UTSW	15	27,741,357 (GRCm39)	missense	probably damaging	0.96
R8828:Trio	UTSW	15	27,741,150 (GRCm39)	missense	possibly damaging	0.93
R8987:Trio	UTSW	15	27,732,773 (GRCm39)	missense	probably benign	0.23
R9051:Trio	UTSW	15	27,732,770 (GRCm39)	missense	possibly damaging	0.78
R9069:Trio	UTSW	15	27,852,097 (GRCm39)	missense	possibly damaging	0.83
R9075:Trio	UTSW	15	27,774,022 (GRCm39)	nonsense	probably null
R9079:Trio	UTSW	15	27,733,023 (GRCm39)	missense	possibly damaging	0.52
R9139:Trio	UTSW	15	27,749,922 (GRCm39)	nonsense	probably null
R9494:Trio	UTSW	15	27,846,843 (GRCm39)	missense	probably benign	0.00
R9680:Trio	UTSW	15	27,744,158 (GRCm39)	missense	possibly damaging	0.93
R9720:Trio	UTSW	15	27,847,495 (GRCm39)	missense	probably benign	0.00
R9726:Trio	UTSW	15	27,912,752 (GRCm39)	missense	unknown
X0024:Trio	UTSW	15	27,765,812 (GRCm39)	missense	possibly damaging	0.91
Z1176:Trio	UTSW	15	27,771,473 (GRCm39)	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- ACAGGATGTGATGTTGCCGATG -3'
(R):5'- CTGCTAAGTCCCCTGCAAAG -3'

Sequencing Primer
(F):5'- TTGCCGATGGTAGATGGAAACC -3'
(R):5'- CCTGCAAAGTAAACCTGTAGACTTGG -3'

Posted On

2019-06-26